1.17k likes | 1.95k Views
DNA Transcription and Translation. Sections 12.3 and 12.4. Do Now. 1. What is RNA 2. How does it differ from DNA? 3. What is protein?. Gene. Segment of DNA that codes for a protein DNA codes for RNA and RNA makes protein. One Gene – One Enzyme.
E N D
DNA Transcription and Translation Sections 12.3 and 12.4
Do Now • 1. What is RNA • 2. How does it differ from DNA? • 3. What is protein?
Gene • Segment of DNA that codes for a protein • DNA codes for RNA and RNA makes protein
One Gene – One Enzyme • The Beadle and Tatum experiment showed that one gene codes for one enzyme. • One gene codes for one polypeptide. • polypeptide - a chain of covalently bonded amino acids. • (proteins are made of one or more polypeptide)
RNA • RNA stands for: • Ribonucleic acid • RNA is found: • Nucleus and Cytoplasm
RNA Structure • Like DNA, RNA is made up of subunits called _____________, which are made of three parts: • Sugar (ribose) • Phosphate • Nitrogen Base
RNA’s Nitrogen Bases • Adenine (A) • Cytosine (C) • Guanine (G) • Uracil (U)
There are 3 types of RNA: • Messenger RNA (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA)
All RNA is … • Single stranded • Many different shapes • “Cheap copy” of DNA
Do Now • 1. What is a protein made of? • 2. Explain the process between DNA and proteins.
Transcription • First step in making proteins • Process of taking one gene (DNA) and converting into a mRNA strand • DNA -> RNA • Location: • Nucleus of the cell
Steps to Transcription • 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
Steps to Transcription (Cont.) • 2. One strand acts as a template.
Steps to Transcription (Cont.) • 3. A mRNA copy is made from the DNA template strand by RNA polymerase • 4. A mRNA copy is made until it reaches the termination (stop signal) sequence • 5. The two strands of DNA rejoin.
Transcription animations • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html • http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm
Think- Pair- Share • 1. Where in the cell does transcription occur? • 2. What nucleic acids are involved in the process of transcription? • 3. What is the importance of transcription? • 4. In transcription, how come the whole DNA molecule is not copied into mRNA? • 5. How does one gene differ structurally from another? • 6. Because one gene differs from another, what molecules in the cell will also be different?
mRNA Processing • Pre-mRNA – the original sequence of RNA created during transcription • mRNA reaches the ribosomes
What is RNA Processing? • After transcription the pre-mRNA molecule undergoes processing • 5’ cap is added • Poly A tail is added to the 3’ end • Introns are removed.
Do Now • Label the Transcription diagram
RNA Processing • In Eukaryotes only • Introns- non-coded sections • Exons- codes for a protein • Before RNA leaves the nucleus, introns are removed and exons are spliced together • A cap and poly A tail are added to ends of the sequence • mRNA leaves the nucleus through the nuclear pores
Let’s try an activity (11.5) • http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html
Pg. 339 • Pg. 339
3’ CAUGAUGUACGAUACGUA 5’ cap Let’s an example… • Original DNA Sequence (DNA): • 5’ GTACTACATGCTATGCAT 3’ • Translate it (RNA): • 3’ CAUGAUGUACGAUACGUA 5’ • Add the 5’ cap:
Add a poly A tail onto the 3’ end Poly A tail 3’ CAUGAUGUACGAUACGUA 5’ 3’ CAUGACGGUA 5’ 3’ CAUGACGGUA 5’ cap cap cap Finish the job! • Remove the introns “UGUA” and “AUAC”:
Get a new partner! • DNA Strand of non-template strand: • 5’ ATCGGTAGAGTATTTACAGATA 3’ • Remove introns: • CGGUA UUACAG
Think, Pair, Share • Take a minute think on your own, then pair with your partner, and share your ideas! • Evolutionary, why do you think there are introns? • Where did they come from? • Why do we have them? • Remember there is NO wrong answer!
Proteins are made up of amino acids!!! • Proteins are polymers of amino acids • Only 20 different amino acids • BUT there are hundreds of thousands of different proteins How can this be?
Let’s compare to it to the English language • How many letters are in the alphabet? A,b,c,d,… 26 • How many words are there? Miss, Ings, is, smart, .. Almost infinite! • Each word has a unique structure of letters. • Similar to proteins and amino acids
Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains
How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins
How many amino acids are in a dipeptide chain? How about a tripeptide chain? How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids?
Do Now • Perform transcription on this DNA segment: GCTTCATACGA • Do RNA processing and remove the introns: GAA and UGC • How does this mRNA sequence leave the nucleus? • Where does it go?
Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
Translation • Production of proteins from mRNA • mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins