Module 4 – Mutational analysis of the lac operon

1. Module 4 – Mutational analysis of the lac operon Week 1

2. Overview • Week 1: Bioinformatics to identify mutations in DNA and analyze restriction enzyme maps • Week 2: Confirm mutations using RE digestion and agarose gel electrophoresis • Week 3: Oral presentations of the lac operon mutants we discover.

3. Structure of the E. coli lacoperon • Operons are regulatory units in bacterial genomes • Promoter region (above) controls when transcription of mRNA from DNA template occurs • Lac operon controls expression of three genes needed for metabolizing lactose • LacZ, LacY and LacA genes CAP -35 -10 Oper. Start LacZ coding region

4. Nucleotide sequence in promoter region of lacoperon • CAP = cAMP binding protein (CAP) recognition site • -35 and -10 are transcription factor binding sites • Operator/LacI = Operator region when the LacI inhibitor protein binds • Trans. Start = place where RNA polymerase binds to start transcription • ATG codon is the starting methionine of the coding region for β-Gal CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGG CTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGA GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT CAP -35 -10 Oper. Start LacZ coding region CAP binding site -35 site -10 site Operator/LacI… …binding site Transcription start Methionine start

5. Regulation of the lacoperon by sugar • Absence of glucose and presence of lactose required for activation of transcription of the lacoperon. Glu Lac CAP -35 -10 Oper. Start Coding region RNA polymerase binds and transcribes DNA

6. Plasmids are autonomous,self-replicating DNA molecules • Plasmids are closed, circular, double-stranded DNA • Small size (<10 kb) allows efficient transfer into cell • Autonomously replicate (separate from chromosomal DNA of host) • Selectable marker (e.g., antibiotic resistance gene, ampicillin) discriminates plasmid-containing cells • Multiple cloning site (MCS) allows insertion of foreign DNA using restriction enzymes

7. Using plasmids as carriers of genetic material • Example shown is genomic DNA • Insert DNA fragments into cloning vector • Once created, plasmids can be purified and analyzed for genetics mutations

8. Inserting the lacoperon into the plasmid allows us to look for mutations • A set of plasmids is available in which the wild-type lacoperon and mutant lacoperons have been cloned into a plasmid • Increased size of plasmid due to insert • Easy to purify, sequence the DNA, and analyze using restriction enzymes

9. DNA sequences for lacoperon will be provided to you • pLac/WT is the DNA sequence for the lacoperon without mutations • Mutants m1 through m7 will be compared with the WT for genetic variations • Types of mutations you might find: • Substitutions • Insertions (frameshift?) • Deletions (frameshift?) • Truncation

10. Compare DNA sequences using a program that performs alignment • Biology Workbench 3.2 will be used • Enter sequences of WT and your mutant • Using ALIGN program to perform alignment

11. Alignment results • A portion of the alignment results shown below • Length of sequences reported • Identify number of identities/mis-matches

12. Restriction endonucleases: molecular scissors • Enzymes that cleave double-stranded DNA at specific restriction site on DNA • Recognize very specific base sequences • Usually palindromic sequences • Two strands are identical when read in same polarity • Typically 4-8 nucleotides in length • Cleavage of bond on each strand often leads to “sticky ends” with nucleotide overhang • Blunt ends occur when restriction enzyme does not leave overhang

13. Many restriction enzymes create “sticky ends” • NdeI: 5’ CATATG 3’ GTATAC • BamHI: 5’ GGATCC 3’ CCTAGG

14. Restriction map • Use the full-length sequence of lacoperon inserted into plasmid backbone • Analyze all possible RE cutting sites with program TACG • Carry out analysis for both WT and mutant. • Look for differences in the RE cutting pattern that can be used as a diagnostic

15. Results from TACG program for pLac/WT • Selected Sequence(s)pLac/WT insert • Enzymes that DO NOT MAP to this sequence • Total Number of Hits per Enzyme • Cut Sites by Enzyme • Pseudo-Gel Map of Digestions • Fragment Sites by Enzyme • Linear Map of Sequence

16. Enzymes that DO NOT MAP to this sequence: • PsrI • RsrII • SapI • SbfI • ScaI • SexAI • SfiI • SfoI • SgrAI • SgrDI • SnaBI • SphI • SrfI • StuI • SwaI • Tth111I • XbaI • XmnI • AarI • AclI • AflII • AgeI • AhdI • AjuI • AjuI • AloI • AloI • ArsI • ArsI • AscI • AsiSI • AvrII • BarI • BarI • BbeI • BbvCI • BglII • BmgBI • BmtI • BplI • BpuEI • BsaI • BseRI • BsmI • BspEI • BspHI • BsrDI • BsrGI • BstAPI • BstEII • CspCI • CspCI • EcoNI • FalI • FseI • FspAI • KasI • KflI • MfeI • MreI • MscI • NaeI • NarI • NcoI • NgoMIV • NheI • NruI • NsiI • PacI • PasI • PmeI • PmlI • PpiI • PpiI • PshAI • PsiI • PsrI

17. Cut Sites by Enzyme (examples) • AatIIG_ACGT'C (0 Err) - 1 Cut(s) 1011 • AbsI CC'TCGA_GG (0 Err) - 1 Cut(s) 286 • Acc65I G'GTAC_C (0 Err) - 2 Cut(s) 271 568 • AcuICTGAAGnnnnnnnnnnnnnn_nn' (0 Err) - 1 Cut(s) 1122 • AfeI AGC'GCT (0 Err) - 1 Cut(s) 2223 • AleICACnn'nnGTG (0 Err) - 4 Cut(s) 1728 2677 3223 3458

18. Determine size of fragments produced • 0 cuts will leave plasmid DNA supercoiled • 1 cut will linearize DNA; need to know total bp to predict its size • 2 cuts will first linearize and then generate two different fragment • Acc65I - 2 Cut(s) at position 271 and 568 • 568-271 = 297 bp • Second piece is 5911 – 297 = 5614 bp • Separating RE digest shows two bands at these sizes

19. Comparing WT and mutant RE maps can reveal differences in predicted fragment size • Look for appearance or disappearance of a restriction site • Look for a large shift in the size of a fragment of the mutant versus WT DNA

20. Homework • Email or give to Krist by next Tuesday • Exercise #1 • Copy of your alignment • Answers to three questions • Exercise #2 • Copy of your restriction analysis output • Answers to two questions • Next time: use the restriction analysis to cut the DNA and run gels