Lesson 5: Transcription & Translation

1. Lesson 5: Transcription & Translation • LT: Be able to explain the process of DNA transcription.

2. THE BIG PICTURE!!! DNA Transcription Translation RNA protein

3. Notes from reading pgs. 425-426 • RNA = ribonucleic acid • Made of nucleotides • Sugar in nucleotides is ribose • RNA uses uracil instead of thymine • RNA is single-stranded and not double stranded • mRNA = messenger RNA • Carries the message of DNA from the nucleus to the cytoplasm to be made into a protein • Transcription: the process by which DNA is copied into a complementary RNA molecule

4. Process & Procedure: Modeling Transcription • Create a double stranded DNA molecule that is 15 bases long Our Code: RED = adenine (A) BLUE = thymine (T) YELLOW = cytosine (C) GREEN = guanine (G) BLACK = uracil (U) Work through step #3a-f

5. Stop & Think • How is DNA transcription like DNA replication? How are the 2 processes different? In this activity, you transcribed 2 different DNA strands. Each one was only 15 nucleotides long. That seems pretty short. a. How many different arrangements of nucleotides are possible in a strand of DNA that is 15 nucleotides long? Same: complementary bases, DNA acts as a template Different: transcription uses uracil, replication uses thymine 4^15 = 1,073,741,824 possibilities

6. How would the number in 2a compare with the number of different arrangements of nucleotides possible in a real strand of DNA? 4^80,000,000 is a ridiculously HUGE number

7. Notes on DNA transcription

8. Do the cells in your eye and your tongue have the same functions? Do the cells in your eye and your tongue have the same proteins?

9. Do the cells in your eye and your tongue have the same DNA?

10. What have we learned? • Proteins determine most characteristics of a cell and organism • Information stored in DNA determines which proteins can be made by a cell • The environment influences which proteins are made by a cell

11. Where is protein made in a cell?

12. DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes Elodea leaf cell human cheek cell mitochondria chloroplasts vacuole nucleus (DNA here) (DNA here)

13. DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes ribosomes (proteins made here) (proteins made here) nucleus (DNA here) (DNA here)

14. DNA and ribosomes are at different locations in a prokaryoic cell. E. coli bacteria cell ribosomes (proteins made here) DNA

15. Information flow from DNA to trait Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus So how does DNA get turned into a protein if it can’t leave the nucleus???

16. messenger RNA • mRNA transfers information from the DNA in the nucleus to the ribosomes. • mRNA is made in the nucleus and then travels to the cytoplasm through nuclear pores • Ribosomes build proteins according to the mRNA information received.

17. Information flow from DNA to trait messenger RNA Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus

18. DNA information  mRNA information Transcriptionis the process used to convert DNA information into mRNA information. Note: DNA does not become RNA; the information in DNA is copied as RNA messenger RNA DNA

19. RNA is different than DNA • Single strand of nucleotides • Contains uracil (U) instead of thymine (T) • Made of the 5-Carbon sugar Ribose instead of deoxyribose (DNA) http://www.makingthemodernworld.org.uk/learning_modules/biology/01.TU.03/illustrations/01.IL.09.gif

20. Difference between DNA and RNA

21. Different Sugars DNA RNA Can you spot the difference?

22. Different Bases Can you spot the difference?

23. DNA- double stranded RNA- single stranded

24. RNA and DNA Nucleotides DNA RNA

25. RNA IS COPIED FROM DNA COPIED DNA (double stranded original, protected in nucleus) RNA (single strand - mobile)

26. mRNA: the messenger RNA is how the body gets information from the nucleus (DNA) to the place where protein gets made (ribosomes)

27. 3 Types of RNA mRNA: messenger RNA tRNA: transfer RNA rRNA: ribosomal RNA

28. THE BIG PICTURE!!! DNA Transcription Translation RNA protein

29. http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpghttp://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg

30. Transcription • Molecule of DNA is copied into a complimentary mRNA strand http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg

31. RNA Polymerase • RNA polymerase is an enzyme • Attaches to promoters (special sequences on the DNA) • Unzips the two strands of DNA • Synthesizes the mRNA strand https://publicaffairs.llnl.gov/news/news_releases/2005/images/RNA_polymerase309x283.jpg

32. Steps of Transcription Step 1: RNA polymerase attaches to DNA Step 2: RNA polymerase unzips DNA Step 3: RNA polymerase hooks together the nucleotides as they base-pair along the DNA template Step 4: Completed mRNA strand leaves the nucleus

33. Transcription http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg

34. If the DNA code is this: TACGAGTTACATAAAATGCTCAATGTATTT What is the mRNA code? Use the bottom strand as the template for mRNA UACGAGUUACAUAAA

35. Which proteins are made in a cell? • Controlled by activator molecules • Bind to enhancers (segments of DNA) • “Turns on” transcription of the gene Example: Arabinose and araC protein

38. Information flow from DNA to trait Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus

39. Information flow from DNA to trait messenger RNA Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus Transcription Transcription Video

40. Part II: Translation LT: Be able to explain the process of translation.

41. THE BIG PICTURE!!! DNA Transcription Translation RNA protein

42. Information flow from DNA to trait Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus

43. Information flow from DNA to trait messenger RNA Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus Transcription

44. Information flow from DNA to trait messenger RNA Observed trait DNA protein Made by ribosomes outside of nucleus Stored in nucleus Translation

45. mRNA information  protein Translationis the process used to convert mRNA information into proteins. - also known as “protein synthesis” Note: mRNA does not become a protein, the information on mRNA is “read” and ribosomes assemble proteins from this code messenger RNA protein

46. http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpghttp://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg Translation • Ribosomes use mRNA as a guide to make proteins

47. 4 Components used in Translation • mRNA- the message to be translated into protein. • Amino acids- the building blocks that are linked together to form the protein. • Ribosomes- the “machines” that carry out translation. • tRNA(transfer RNA)- brings an amino acid to the mRNA and ribosome.

48. The message • mRNA is a strand of nucleotides • Ex. AUGCCGUUGCCA… • Each combination of three nucleotides on the mRNA is called a codon

49. http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gifhttp://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif tRNA • Transfer RNA • Single strand of RNA that loops back on itself • Has an Amino Acid attached at one end • Amino Acids are the building blocks of proteins • Has an anticodon at the other end

50. http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gifhttp://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif What is an anticodon? • The anticodon is a set of three nucleotides on the tRNA that are complimentary to the codon on the mRNA