1 / 21

PROTEIN SYNTHESIS

PROTEIN SYNTHESIS. 3 Types of RNA. mRNA= messenger tRNA= transfer rRNA= ribosomal. The Central Dogma. DNA The master program of the cell Never leaves the nucleus Transcription Process that makes mRNA from DNA Takes place in the nucleus Translation Process that makes proteins from mRNA

elaine-key
Download Presentation

PROTEIN SYNTHESIS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PROTEIN SYNTHESIS

  2. 3 Types of RNA • mRNA= messenger • tRNA= transfer • rRNA= ribosomal

  3. The Central Dogma • DNA • The master program of the cell • Never leaves the nucleus • Transcription • Process that makes mRNA from DNA • Takes place in the nucleus • Translation • Process that makes proteins from mRNA • Takes place in the cytoplasm

  4. Steps in Transcription • Initiation • Elongation • Termination • When complete, pre-RNA molecule is released

  5. Transcription

  6. Question: • What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

  7. pre-RNA molecule exon intron exon exon intron intron intron exon exon exon splicesome splicesome exon exon exon Mature RNA molecule RNA Processing

  8. Translation • Synthesis of proteins in the cytoplasm • Involves the following: 1. mRNA (codons) 2. tRNA (anticodons) 3. ribosomes 4. amino acids

  9. Translation • Three steps: 1. initiation: start codon (AUG) 2. elongation: amino acids linked 3. termination: stop codon (UAG, UAA, or UGA).

  10. mRNA A U G C U A C U U C G mRNA Codons Join the Ribosome Large subunit P Site A Site Small subunit

  11. aa2 aa1 2-tRNA 1-tRNA G A U U A C Initiation anticodon A U G C U A C U U C G A hydrogen bonds codon mRNA

  12. aa3 3-tRNA G A A Elongation peptide bond aa1 aa2 1-tRNA 2-tRNA anticodon U A C G A U A U G C U A C U U C G A hydrogen bonds codon mRNA

  13. aa3 3-tRNA G A A aa1 peptide bond aa2 1-tRNA U A C (leaves) 2-tRNA G A U A U G C U A C U U C G A mRNA Ribosomes move over one codon

  14. aa4 4-tRNA G C U peptide bonds aa1 aa2 aa3 2-tRNA 3-tRNA G A U G A A A U G C U A C U U C G A A C U mRNA

  15. aa4 4-tRNA G C U peptide bonds aa1 aa2 aa3 2-tRNA G A U (leaves) 3-tRNA G A A A U G C U A C U U C G A A C U mRNA Ribosomes move over one codon

  16. aa5 5-tRNA U G A peptide bonds aa1 aa2 aa4 aa3 3-tRNA 4-tRNA G A A G C U G C U A C U U C G A A C U mRNA

  17. aa5 5-tRNA U G A peptide bonds aa1 aa2 aa3 aa4 3-tRNA G A A 4-tRNA G C U G C U A C U U C G A A C U mRNA Ribosomes move over one codon

  18. aa5 aa4 Termination aa199 aa200 aa3 primary structure of a protein aa2 aa1 terminator or stop codon 200-tRNA A C U C A U G U U U A G mRNA

  19. aa5 aa4 aa3 aa2 aa199 aa1 aa200 End Product –The Protein! • The end products of protein synthesis is a primary structure of a protein • A sequence of amino acid bonded together by peptide bonds

  20. Question: • What would be the Amino acid sequence for the following mRNA strand? mRNA CGAUGUUCAGACGCGGGUAACG

More Related