1 / 32

Molecular Basis of Weak D in Indians

Molecular Basis of Weak D in Indians. Dr Swati Kulkarni Head, Dept. of Transfusion Medicine ICMR- National Institute of Immunohaematology, Mumbai. Introduction. The Rh blood group system - most polymorphic system

floydzamora
Download Presentation

Molecular Basis of Weak D in Indians

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Basis of Weak D in Indians Dr Swati Kulkarni Head, Dept. of Transfusion Medicine ICMR- National Institute of Immunohaematology, Mumbai

  2. Introduction • The Rh blood group system - most polymorphic system • High immunogenicity - correct determination of the RhD status important as implicated in HTR and HDFN. • Serologically, the task of determining an individual’s RhD status seems simple enough unfortunately, it is not always that simple. • The Rh antigen complexities have long been recognized • initially in serologic testing, • more recently as a result of more number of antigens recognized, • the variable expression of antigens, • availability of monoclonal anti-D Although most people are either D pos or D neg, there is a plethora of D variants. Most of these D variants are clinically important as they can lead to production of anti-D when their blood is transfused to RhD negative individuals or they are transfused with normal D pos blood. Therefore identification of these individuals important.

  3. RhD variants Schematic representation of antigens and epitopes on weak D, partial D, and normal D positive red cells. 1: Normal D antigen with all epitopes, 2: Weak D with reduced D antigenic sites and all epitopes present, 3: Partial D with normal D antigenic sites but lacking one D epitope, 4: Partial D with normal D antigenic sites but lacking two D epitope, 5 : Partial weak D with reduced D antigenic sites and lacking one D epitope.

  4. Clinical implications of the D antigen

  5. Variables Affecting D Typing Results Multiple methods: • test tube, gel, solid phase, automation, molecular • may or may not proceed for Du testing • Different for Donors/patients • Variability in expression of D - same D variant type reacts differently with one reagent and different methods • Reagents • Methods • Strength of reaction • Interpretation of results • Donor / Recipient / Cord blood / ANC Confusions Over Weak Expression of D Individual’s Rh status Donor Recipient Prenatal RhIg? Newborn Postpartum RhIg? Autologous A donor can be a patient tomorrow – correct RhD status important

  6. As various commercial anti-D reagents directed against the different epitopes and the techniques used in determining the RhD status vary from one laboratory to another, a RhD variant can be mistyped as D-negative in routine testing. • DEL variants only detected by adsorption elution techniques, are not performed routinely thus not identified • Limitations of serology warrant - molecular genotyping - to predict RhD phenotype • This phenotypic variability - genetic polymorphisms, involves several mutational mechanisms, ranging from single nucleotide variations to whole RHD gene deletion

  7. Genetics of Rh Blood Group System • Two closely linked and highly homologous Rh genes (RHD and RHCE) • chromosome location 1p36.1. • Both RHD and RHCE genes have 10 exons each spanning over 75 Kb of DNA and face each other with their 3’-end. • They encode for 417 AA which form transmembrane protein with 6 extracellular loops. • The RHD gene -D antigen and RHCE -C/c and E/e antigen • Close proximity • Opposite orientation • 96% homology Promotes genetic exchange Produces clinically relevant Rh variants.

  8. RhD Positive RhD Negative (Deletion) RhD Negative (Pseudogene) RhD Negative ( Hybrid allele) Representative diagram of RH genes in RhD positive and RhD negative phenotypes. Coding regions consist of 10 exons, depicted as black and grey boxes for RHD and RHCE respectively.

  9. RhD variant phenotypes and their molecular basis RHD exon RHCE exon

  10. Several phenotype studies have reported the incidence of RhD-negative individuals, weak D and partial D antigen carriers in India. • Phenotypic data in terms of D antigen density and their distribution in different castes and communities of the Indian population have also been provided, but extensive genetic studies on Rh antigens have not been carried out in Indians.

  11. Weak D –Indian studies Weak D prevalence 0.01% in 1, 84,072  donors The incidence of weak D Rh antigen was 0.189% in 34932 donors The prevalence of weak D (Du) in Western Indian population is 0.056 % in 38,962 donors

  12. DEL variants in Indians The frequency of DEL phenotype detected by adsorption and elution in Rh negative donor population of North India is 1.5%. (3 variants in 200 D-negative donors) Serologically DEL phenotype found to be absent in 900 RhD negative individuals by adsorption elution. PCR-SSP for RHD(K409K) common in Asians and RHD(M295I) common in Caucasians also screened.

  13. Aimwas to characterize the molecular bases of weak expression of D antigen in Indians, with an objective of creating a database of RHD variant alleles prevalent in Indians • Samples obtained by screening RhD negative individuals -3019 • ambiguous RhD typing (n = 156) due to • discrepancy in strength of agglutination reaction between two anti-D reagents, • weak strength of agglutination, • D+ samples producing anti-D and • samples showing discrepancy in present and historical test results • Serological screening: • 5 different commercial monoclonal anti-Ds reagents • Advanced Partial RhD typing Kit • DEL variants, by ether elution method • Rh phenotyping • D antigenic sites flow cytometric method

  14. Molecular analysis • Genomic DNA was extracted from whole blood using Qiagen FlexiGene DNA kit • Initially, the strategy was to screen for presence of the weak D type 1, 2 and 3 alleles by Real Time PCR as these are the mostcommon mutations in the Caucasian population. • For the uncharacterized samples, theten RHD exons and theirflankingintronicsequenceswereamplified in a single tube by a multiplex PCR • Alternatively copy number variations (CNVs) of RHD exons were analyzed by RHDQuantitative Multiplex PCR of Short Fragments (QMPSF) for exon quantitation. • Briefly, the tenRHD and RHCE exons wereamplified in twoseparate single tube reactions by a multiplex PCR withHFE and F9 as control genes. • The reaction ends within the exponential quantitative phase. Two control HFE and F9gene-specificsequences. • The fragments werethenanalysed on the automatedcapillary DNA sequencer in presence of a size standard using a dedicated software. • RHCE QMPSF was carried out when a hybrid RHD-CE-D gene was suspected

  15. Results Serology 2.2% of serological D negative – D variants No DEL variants Total – 223 weak D variants 220 (+2-+w) at IgM phase Advanced Partial D kit- varied reactivity pattern, mostly Ep 1.2 absent • Molecular • Screen for presence of the weak D type 1, 2 and 3 • No variant allele was identified by this method, suggesting that the molecular bases of weak D phenotype are different between Indians and Caucasians. Example of melting curves after specific amplifications for the genotyping of the weak D All the ten RHD exons were then directly sequenced in these samples. Single nucleotide variations were found in only in few samples, suggesting that this mutational mechanism is not so common in the Indian population

  16. QPMSF analysis RHD gene Presence of entire RHD gene in D positive Deletion of entire RHD gene in D negative

  17. Screening of D variants samples by RHD QMPSF • a wild-type pattern with all RHD exons present • two copies of RHD exon 3 in many samples • Tested for all RHCE exons as suspecting hybrids with RHCE, but all RHCE exons present • A novel duplication in exon 3 and flanking regions identified in (~58%) weak D allele tested A e3 e5 e2 e9 e6 e4 F9 e1 HFE e10 e7 e8 Hemizygous, wild-type RHD B Hemizygous exon 3 duplication C Homozygous exon 3 duplication Exon 3 dup

  18. RHD alleles found in the Indian weak D samples screened by serological analyses

  19. Other novel variant D alleles 3 missense variations - RHD(A59T), RHD(G63C), RHD(A237V) 3 complexhybridalleles - RHD-CE(5:E233Q,V238M,V245L)-D RHD(T201R)-CE(5)-D(I342T) RHD(L214F)-CE(7)-D) Sequencing patterns of novel variant RHD alleles A RHD-CE(5:E233Q,V238M,V245L)-D Control Sample Exon 5 c.697G>C p.Glu233Gln Exon 5 c.712G>A p.Val238Met Exon 5 c.733G>C p.Val245Leu Exon 5 c.744C>T Synonymous Single nucleotide variations identified by direct sequencing Arrowheads indicate nucleotide variations in samples compared with wild-type sequences. B C D RHD(G63C) RHD(A59T) RHD(A327V) Control Control Control Sample Sample Sample Exon 2 c.187G>T p.Gly63Cys Exon 2 c.175G>A p.Ala59Thr Exon 5 c.710C>T p.Ala327Val

  20. Serological characteristics of the novel mutations Exon 3 duplication • (+2-+w) at IgMphase barring three samples which could only be identified in the IgG phase. • Rh phenotyping • 124/130 samples positive for the C antigen • 6/130 individuals (ccee: n = 4; ccEe: n=2) • Three samples homozygous for the exon 3 duplication presented with a C+c–E–e+ phenotype.

  21. Extended phenotyping: D epitope profile Common agglutination patterns • Testing with Advanced Partial RhD Typing Kit (set of 12 monoclonal anti-D reagents) - varying patterns of agglutination and reaction strength • absence of epitope 1.2 (clones LHM174/102 and LHM70/45) - 86% • absence of epitope 8.1 (LHM76/58 and LHM59/19) - 79% • absence of epitope 6.3 (LHM50/2B, LHM169/80, and LHM57/17) - 61%

  22. Flow cytometric analysis for exon 3 duplication Exon 3 positive sample with different monoclonal anti-D reagents. • Flow cytometry analysis in exon 3 duplication positive samples (n=41) showed a varying weak D antigen density • average mean density  SD: 2753 ± 1351 D antigens/cell; (range: 1276–6050)

  23. Serology of other novel alleles * Epitope in accordance with Scott M. Section 1A: Rh serology. Coordinator’s report. Transfus Clin Biol. 2002;9(1):23-29. † Hybrid 1: RHD-CE(E233Q,V238M,V245L)-D; Hybrid 2: RHD(T201R)-CE(5)-D(I342T); Hybrid 3: RHD(L214F)-CE(7)-D.

  24. RHD genotyping and mapping of duplicated region:To delineate the duplicated region another QMPSF assay based on universal fluorescent labeling was designed. A 1 2 3 4 5 6 7 8 9 10 This customized QMPSF identified a >10-kb duplicated region in weak D individuals Intron 2 (5.9 kb) Intron 3 (10.2 kb) e2 e3 e4 * * * * * i2a i2b i3a i3b i3c * * e3 * Markers * * * * * * Breakpoint regions Minimal duplicated region (>10 kb) B (A)- A novel QMPSF assay was designed by positioning additional markers (*) in introns 2 (i2a, and i2b) and 3 (i3a, i3b, and i3c). i3b i3a i2b e2 e4 F9 HFE e7 i3c i2a Calibrator Sample (B)- Typical QMPSF profiles obtained with a hemizygous, wild-type RHD calibrator (Rh C/c, E/e phenotype: Ccee) (top panel); and a hemizygous (exon 3 duplication) sample (Ccee). Calibrator: hemizygous, wild-type RHD control sample; sample: weak D, hemizygous exon 3 duplication sample.

  25. The novel, Indian weak D allele involves duplication of a 12-kb fragment inserted within RHD intron 3. Breakpoint was PCR-amplified and sequenced with primers RHD_i3ex3dup_F and RHD_i2ex3dup_R in standard conditions Functional consequences of exon 3 duplication • To get insights into the mechanism involved in the expression of a weak D phenotype due to exon 3 duplication we sought to characterize the functional consequences of the allele as follows:- • Total RNA extracted of wild-type, RHD-negative and exon 3 duplication samples- Trizol based method, • Reverse transcribed with cDNA synthesis kit • cDNA amplified by PCR (RHD exon 2-4, exon 6-8, and ACTB). PCR products further subcloned into commercial vector and directly sequenced.

  26. The novel variant RHD allele including duplication of exon 3 impairs cellular splicing. • (A) RT-PCR products on gel. • (B) RT-PCR products from RHD(2-4) amplification were extracted from the gel, subcloned into a commercial vector and sequenced. Four products were found from an exon 3 duplication sample: • (1) exon 2 - exon 3 - exon 3 - exon 4; • (2) exon 2 - exon 3 - exon 3 - exon 4 deleted from the first four base pairs; • (3) exon 2 - exon 3 - exon 4, identical to what observed in a wild-type sample; and • (4) exon 2 - exon 3 - exon 4 deleted from the first four base pairs. A B D+ S D- NTC Exon 2 Exon 3 Exon 3 Exon 4 Sampleproduct 1 RHD(2-4) Sampleproduct 2 RHD(6-8) ACTB Wild-type Sample product 3 D+: wild-type, RHD-positive sample S: exon 3 duplication sample D-: RHD-negative sample NTC: no template control Sample product 4 Exon 2 Exon 3 Exon 4

  27. Important observations from functional studies • This result provides important information about both the genomic rearrangement and the functional mechanism involved in the expression of the weak D phenotype and suggests that • an additional exon 3 is located between exons 2 and 4 in the same orientation; and • although splicing is severely altered and production of wild-type transcript decreases, a wild-type RhD protein may be generated at a low level in agreement with the expression of a weak D phenotype. • Two additional subproductswith deletion of 4 base pairs in either aforementioned amplicons were found, suggesting that processing of the transcript is severely altered by the variation.

  28. Design of an “Indian-specific, RHD genotyping assay” • Next we thought to design a molecular test that may be easily implemented at the laboratory level for genotyping RHD in Indians. • A standard, multiplex PCR assay was designed, including: • GAPDH (internal amplification control), • RHD exon 10 (present in the vast majority of variant RHD alleles), • RHD exon 5 (absent in several partial/null RHD alleles), and • RHD exon 3 duplication-specific marker Indian RhD specific genotyping assay primers designed Primers RHD exon 5 605 bp RHD_e5seqF ATACCTTTGAATTAAGCACTTCACAGAG RHD_e5seqR ACTGTGACCACCCAGCATTCTA Ex3dup breakpoint 407 bp RHD_i3ex3dupF ACGTGTTGAGGGCATGACCTC RHD_i2ex3dupR GCCTGGATTCCTTGTGATACACG RHD exon 10 344 bp RHD_e10seqF AGGCTGTTTCAAGAGATCAAGCCA RHD_e10seqR GATGTTGTTATGTGGTACATGGCTG GAPDH intron 297 bp GAPDH_i2F CCCCACACACATGCACTTACC GAPDH_i2R CCTAGTCCCAGGGCTTTGATT

  29. Indian-specific, multiplex PCR RHD genotyping RHD-004 Exon 3 duplication RHD-009 Exon 3 duplication RHD-030 Exon 3 duplication RHD-048 D cat VI, type 1 (D-CE(4-5)-D) RHD-049 D cat VI, type 3 (D-CE(3-6)-D) RHD-221 Weak D type 4.2.2 Interpretation guide for genotyping assay +: positive PCR amplification - : no PCR amplification *Test again †Other genotyping methods may be considered (sequencing, microarray, QMPSF…).

  30. Novel, predominantRHD variant allelespecific to the Indian population. • Novel RhD variants gave weaker reaction at IgM phase of testing and did not require IAT for detection. • Majority of the variants show ‘C’ antigen positivity • Discovery of new molecular mechanism involved in the production of novel weak RhD variant. • Development of an Indianspecificgenotypingassay for the RHDgene. • This studyextends the currentknowledge of RHmoleculargenetics but alsoextends the spectrum of mutational mechanisms involved in the variability of Rh expression. • The study contributes to improve Rh blood group diagnostics significantly in more than one billion Indians.

  31. Rh variants around the world Rh phenotype variability studied in Caucasian, African and East Asian origins and hundreds of variations have been documented and registered in the RhesusBase (www.rhesusbase.info/) (Sandler et al 2017, Daniels 2013)

  32. THANKS

More Related