Supplementary figure 2

1. Supplementary figure 2 +/+ +/m kb 12 8 M +/+ +/m m/m 2 kb 540bp 387bp a. b. c. d. Supplementary figure 2. Generation of Unc5b mutant mice a. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain. b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’34. The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b. The following primers were used: Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG, Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

2. Supplementary figure 2 % normalized expression level f. +/+ +/m m/m kb exons amplified: 0 50 100 9.49 5,6 7.46 6,7 4.40 8,9 9,10 2.37 Probe: exons 1-17 11,12 12,13 9.49 7.46 13,14 14,15 4.40 15,16 16,17 2.37 Probe: exons 5-17 +/+ +/m m/m 18S rRNA e. Supplementary figure 2 (continued). Generation of Unc5b mutant mice e. Northern blot analysis of total RNA from E10.5 embryos using the probes indicated. Wild-type transcripts were not detected in the mutant. +, wild-type allele; m, mutant allele. f. Real-time RT-PCR analysis of total RNA from E10.5 embryos. The coding regions amplified by different primer pairs are indicated on the left. Expression levels in wild-type are set to 100 percent. Expression levels in the mutants on average are less than 3 percent of wild-type for all coding regions 3’ to the site of gene targeting. +, wild-type allele; m, mutant allele. The following primer pairs were used: Unc5b: ACAGGCACTCCCTCCGGTGG/ATCGTCTATGTGAATGGAGG TTGCACCACCGTGTGCCCAG/TGCCATGCACTCGCGGCTGC ATCAGAGAACTCTAAACGAC/ACCGCTACCACCACAAAGAC CAAGGCCCAACAACCCGCAG/TGTCGGCGGAGTCCTGCAGG AGCCTGTTGGTACCAAATGG/TTCTGAAAGTGGGAGGGTGC ACTGGGAGGAGGTGGTGACC/AGCTGGTCCAGCAGGATGTG ACACACCTGTAGCACTGAAG/GTAGGTTGTGGTAACTGTCC TGGCCAAGTACCAGGAGATTC/TCCGTGGAGGCCAGGCTATG TTGGCCGAGACGCCTGCTGG/TATCTTGAAGGCATAGGGTC CAGAAGCTGTCCATGGACCG/TCATCCTGTTGCCGAGCTTC Transferrin receptor:TGGGAACAGGTCTTCTGTTG/TGCAGTCCAGCTGGCAAAGA.