1 / 7

Essential Basic Part Types

Essential Basic Part Types. Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV)

geraldine-reagan
Download Presentation

Essential Basic Part Types

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV) Ribosome Binding Sites (RBS) - Sequence encoding a ribosome binding site, fused 5' to an ORF part Terminators (TT) - Sequence causing transcription termination (and more can come later, with their own part definitions and standards rules)

  2. Potter Standard Polylinker GAATTCaaaAGATCTPARTSEQUENCE1GGATCCaaaCTCGAG AGATCTPARTSEQUENCE1GGATCC AGATCTPARTSEQUENCE2GGATCC GlySer AGATCTPARTSEQUENCE1GGATCTPARTSEQUENCE2GGATCC

  3. Type I Coding Sequences AGATCTATG_MIDDLE_OF_PART_TAAGGATCC AGATCTGTG_MIDDLE_OF_PART_TGAGGATCC • The start and stop codons are placed directly adjacent to the BglII and BamHI sites, respectively • Start codons are free to be ATG, CTG, TTG, or GTG

  4. Coding Sequences Type II AGATCTATGAAATTTCCCGGGAAATTTGGATCC Type III AGATCTCATCATCATCATCATCATTAAGGATCC Type IV AGATCTAAATTTCCCGGGAAATTTCCCGGATCC • Coding sequences allow the construction of ORF fusions for chimeric and tagged proteins. GlySer scars separate junctions between fused peptides.

  5. Ribosome Binding Sites AGATCTGAAAGAGGAGAAAGGATCC • The spacing of a ribosome binding site relative to the start codon is fixed. Shown is a (likely) strong RBS AGATCTATG_ORF_Part_TAAGGATCC .RBS. AGATCTGAAAGAGGAGAAAGGATCTATG_ORF_Part_TAAGGATCC

  6. Promoters +1 | AGATCTTCC_Middle_of_Ptet_TAGAGATACTGAGCACGGATCC • The transcriptional start site (+1) is located at the position directly 5' to the BamHI site (whenever possible)

  7. Terminators ...CUUUCUGCGUUUAUA3' | AGATCTCCA_Middle_of_Ptet_CTTTCTGCGTTTATAGGATCC • The transcriptional termination site is located at the position directly 5' to the BamHI site (whenever possible)

More Related