1 / 23

Kinetics of Promoter escape varies as a function of kCL concentration.

Kinetics of Promoter escape varies as a function of kCL concentration. Sophiya Karki and Elina Shrestha Dr. Lilian Hsu, Biochem Dept. Background. k E. K B. RPo. EC + Full length RNA. k 2. R+P RPc R : RNA Polymerase (RNAP) P : Promoter DNA

hedda
Download Presentation

Kinetics of Promoter escape varies as a function of kCL concentration.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Kinetics of Promoter escape varies as a function of kCL concentration. SophiyaKarki and ElinaShrestha Dr. Lilian Hsu, Biochem Dept.

  2. Background kE KB RPo EC + Full length RNA k2 • R+P RPc • R : RNA Polymerase (RNAP) • P : Promoter DNA • RPc : RNAP-promoter closed complex • RPo : Productive RNAP-promoter open complex • RPo' : Unproductive RNAP-promoter open complex • EC : Elongation complex k-2 RPo’ Abortive transcripts Fig 1. Kinetic diagram of Transcription Initiation

  3. Promoters Studied and Past Observation Initial Transcribed Sequences (ITS) N25(-C) Promoter (Escape competent) AUAAAUUUGA GAGAGGAGUU UAAAUAUGGC Up stream +20 +1 +3 G29 Transcription start site N25anti(-A) Promoter (Escape incompetent) GUCCGGCGUC CUCUUCCCGG UCCGUCUGGC UGGUUCUCGC A +20 +1 +3 C40 N25anti promoter escapes 10 folds slower than N25 as indicated by the long escape half life but produces higher amounts of full length RNA. (Nwe-Nwe Aye-Han, 2007. Senior Thesis)

  5. OBJECTIVE • To study the efficiency of promoter escape at various KCl concentrations for the two promoters, N25 and N25anti, differing only in their Initial Transcribed Sequence(ITS).

  6. Concentration of KCl as a Factor in Transcription Initiation and Promoter Escape • KCl concentration may affect multiple steps during transcription initiation. • Open complex formation, stability and collapse. • Promoter escape Current interest : • Observe variation in escape rate and productive yield as a function of [KCl]. • Performed time-course transcription for four [KCL], 200mM, 100mM, 50mM and 10mM

  7. Experimental procedures N25(-C) Promoter AUAAAUUUGA GAGAGGAGUU UAAAUAUGGC • Experimental Setup Single-cycle Templates: RNAP N25anti(-A) Promoter GUCCGGCGUC CUCUUCCCGG UCCGUCUGGC UGGUUCUCGC A 3’deoxy CTP +1 G29 +1 C40 Template Confirmation: PL: long PCR fragment of 348 bp spanning -234 to +114

  8. Single-cycle Transcription reaction The reactions were performed under single-cycle polymerase limiting conditions. The N25 and N25 anti promoters were modified such that they had one of the four nucleotides missing in the first 30 to 40 nucleotides of their initial transcribed sequences. This allows for the halting of polymerase after a round of initiation and elongation when supplied with the 3’-deoxy form of the missing nucleotide, and the rest 3 NTPs. Methodology:

  9. In rate diagram, KB is the binding constant that governs the rapid equilibrium of the formation of closed complexes. The figure illustrates the branched pathway model for abortive and productive initiation. The closed ITCs can partition into either productive (RPo) or unproductive (RPo’) open complexes. The productive complexes can undergo escape to give rise to full-length RNA (FL), though only after some cycles of abortive initiation. The unproductive complexes are limited to producing abortive transcripts. The synthesis of FL showed a time course of single exponential rise which fit the equation [y=m1 +m2*(1-exp(-m3*x) where m1=0]. The m3 (kE) and m2 represent the composite rate constant of escape and the plateau level of FL respectively. Extracting these values allowed us to measure the half life of escape (t1/2=kE/ln2) and the productive fraction (m2 in fmoles).

  10. AUAAAUUUGA GAGAGGAGUUUAAAUAUGGC [α-32P] UTP labeled full length RNA Include in the paragraph -Incubate A mix at 370C for 10 mins to form open complexes. -Transfer the B mix into A mix. -At each time points take 5ul aliquots of reaction mixture and add into 5ul FLB to terminate the reaction. 18 time points were taken. • Single cycle transcription (RNAP limiting condition)

  11. Time course Transcription in 200mM KCl of N25 promoter 30’’ 1’ 1.5’ 2’ 2.5’ 3’ 3.5’ 4’ 4.5’ 5’ 7’ 10’ 15’ 20’ 30’40’60’90’ Time Points dilutions 1:30 1:90 1:270 1:810 1:2430 IQV Full length RNA Abortive RNA Radioactivity of the reaction mixture from full length RNA is counted by the scintillation counter in cpm (counts per minute) and the RNA bands are measured in Image Quant Volume (IQV) units.

  12. Half Life of full length RNA produced in 200mM KCl= 4.0 mins y= A(1-e-kx)

  13. Experimental Results N25 promoter N25anti promoter In N25 promoters, lower the concentration of KCl, faster is the escape and higher is the productive yield. In N25anti promoters, lower the concentration of KCl, higher is the productive yield. However, the rate of escape is NOTincreasing as in N25.

  14. Graphical Overview

  15. Conclusion • KCl concentration influences the partitioning step in transcription initiation similarly in N25 and N25anti promoters . • KCl concentration affects the rate of promoter escape in N25 and N25anti promoters differently since rate of escape is highly governed by their ITSs.

  16. Observed data for N25

  17. N25anti (A-):PL t=3-270 min A41 U14 U12 C10 G8 C7 G6 G5 C4 50mM KCl

  18. N25anti (A-): PL t=3-270 min t=3-270 min A41 A41 U14 U12 U12 C10 G8 C7 G6 G5 C4 C3 U2 U12 10mM KCl

  19. N25anti (A-) :PL t=3-270min A41 U14 U12 C10 G8 C7 G6 G5 C4 100mM KCl

  20. N25anti (A-):PL t=3-270min A41 U14 U12 C10 G8 C7 G6 G5 C4 C3 U2 150mM KCl

  21. N25anti(A-):PL t=3-270min A41 U14 U12 C10 G8 C7 G6 G5 C4 C3 U2 200mM KCl

  22. N25 (-C):PL T=3-90min C30 G11 G9 U8 U7 U6 A5 C4 C3 U2 200mM KCl

More Related