760 likes | 911 Views
Introduction to Bioinformatics Tuesday, 29 January. X. Can we push the due date to Friday?. Introduction to Bioinformatics Tuesday, 29 January. Comments from Questionnaire. I need a textbook to teach me the basics. Introduction to Bioinformatics Tuesday, 29 January.
E N D
Introduction to BioinformaticsTuesday, 29 January X Can we push the due date to Friday?
Comments from Questionnaire I need a textbook to teach me the basics.
Introduction to BioinformaticsTuesday, 29 January I need a textbook to teach me the basics.
Comments from Questionnaire What is the purpose of a DNA library? I'm not really sure how to go about figuring out how much 1X of the genome would be. How much what? Is this referring to nucleotides or contigs? What do you do think is the better option for everyday sequencing use in the real world: Dideoxy or shotgun genome? I don't understand the purpose of mates.
Shotgun Sequence of a Genome Drosophila genome (~100 million nt)
Shotgun Sequence of a Book Marley was dead, to begin with. There is no doubt whatever about that. The register of his burial was signed by the clergyman, the clerk, the undertaker, and the chief mourner. Scrooge signed it. And Scrooge's name was good upon 'Change for anything he chose to put his hand to. Old Marley was as dead as a doornail.
Shotgun Sequence of a Book Marley was dead, to begin with. There is no doubt whatever about that. The register of his burial was signed by the clergyman, the clerk, the undertaker, and the chief mourner. Scrooge signed it. And Scrooge's name was good upon 'Change for anything he chose to put his hand to. Old Marley was as dead as a doornail.
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead …you would have to oversample a sequence for the shotgun approach to work?
Sequencing process Drosophila genome (~100 million nt) . . . Suppose broken into 500 nt fragments
Sequencing process Drosophila genome (~100 million nt) . . . SAMPLE
Sequencing process Drosophila genome (~100 million nt) . . . SAMPLE
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead Marley was dead, to begin with. There is no doub
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead Marley was dead, to begin with. There is no doub
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead Contig #47 Marley was dead, to begin with. How to connect contigs? Contig #29 There is no doub How to get the snippets?
Dideoxy sequencing CGACCATCGCCTTAGTAC
Myers et al SQ2 What is the sequence (5' to 3') represented by the gel? G A T C
Myers et al SQ2 ddC ddC ddC ddC ddC What is the sequence (5' to 3') represented by the gel? G A T C TCGTGTACATCGTAACACGGTTAAGT
Study Question 4What is high-quality sequence? Could you explain in more detail the fluorescence chart with the waves. To determine high quality sequences,… How do you know when a peak stops being high enough?
Dideoxy sequencing How sure are you? To determine high quality sequences,… How do you know when a peak stops being high enough?
For SQ3, I have been unable to identify the organism/molecule by using BioBIKE. I have tried the function SEQUENCES-SIMILAR-TO.
DNA replication Primer How to provide a primer to an unknown sequence?
Myers et al SQ6 primer primer Why read pairs? Scaffolds? What is the purpose of a DNA library? mates G A T C ~2000 nt insert plasmid
How to connect contigs primer Why read pairs? Scaffolds? Mate pairs dead, to begin with. There is no doub insert ~40 letters plasmid
Myers et al SQ6 ~ 150,000 nt . . . mates Why read pairs? Scaffolds? What is BAC used for again?. Bacterial Artificial CHROMOSOME Marley was dead. God bless us every one. I don't understand the purpose of mates.
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead Contig #47 Marley was dead, to begin with. Contig #29 How to connect contigs? There is no doub
Shotgun Sequence of a Book Marley was begin wit dead, to be ad, to begi There is no doub Marley was dead Marley was dead, to begin with. There is no doub How are gaps between assembled contigs "closed experimentally"?
Shotgun Sequence of a Book with. Ther Marley was dead, to begin with. There is no doubt whatever about that. The register of his burial was signed by the clergyman, the clerk, the undertaker, and the chief mourner. Scrooge signed it. And Scrooge's name was good upon 'Change for anything he chose to put his hand to. Old Marley was as dead as a doornail. Polymerase Chain Reaction (PCR) Requires known primer sequences,one on each of the two strands.
Sequencing vs Assembly GGGATATGTCAGACGGTA AATACAAGAACCCAAGCACCCAATTAA GTCCGATAGGCTCTTGTCG TCTGGAAGCATTTAACCG TAATTCTCTTTGTTATGGTGTCTGACC Contig 1 Contig 2 TGCAGCGTCAGCGAAA TAAATTCTGCTAGTGTCCGGTTTGC CGGATACGCGCGAGAACTGACGACAACTCAGCGA Dideoxy sequencing Sequence assembly G A T C Finishing