In Vivo assay for RNA-protein interactions

1. In Vivo assay for RNA-protein interactions Dana M. Schneider Loren Williams lab

2. Outline • The Ribosome • Yeast three hybrid assay for RNA-protein interactions • Construct vectors • PCR amplify insert • Restriction digest plasmids and insert • Ligate vector and insert • Transform ligation into E. coli • Colony PCR to screen for inserts • Sequence confirmation of inserts • Transform plasmids into yeast • Colony lift assay (qualitative) • Beta-galactosidase assay (quantitative)

3. The Ribosome: Protein and RNA Small Subuntit (SSU) ~ 22 rProteins 16S rRNA Large Subuntit (LSU) ~34 rProteins 23S rRNA 5S rRNA Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) Science 289, 905-920. Selmer, M., Dunham, C. M., Murphy, F. V. t., Weixlbaumer, A., Petry, S., Kelley, A. C., Weir, J. R., and Ramakrishnan, V. (2006) Science 313, 1935-1942. Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels, H., Franceschi, F., and Yonath, A. (2001) Cell 107, 679-688.

4. Deconstruction of the Ribosome L2 L15 a-rRNA L4 L22 L3 Do rRNA fragments interact with rProteins as in the fully assembled ribosome?

5. Methods to detect and characterizeRNA-protein interactions • Electrophoretic mobility shift assay – in vitro • Pull-down assay – in vitro • RNase protection assay – in vitro • Yeast three-hybrid assay – in vivo • in vitro methods • pro: know all constituents • con: may not have all necessary constituents • in vivo methods • pro: don’t know all constituents • con: may have all necessary constituents

6. “High-jacking” transcription regulation RNA-Protein interaction of interest Yeast in vivo Phenotype DNA Binding Site Gene DNA Binding Protein Activation Domain chromosome

7. Yeast Three Hybrid System to identify RNA-protein interactions How do we get yeast to make the RNA and protein hybrids? RNA-X Protein MS2 Activation Domain MS2 RNA-Binding Protein Hybrid 2 Hybrid 3 Yeast in vivo DNA Binding Protein DNA Binding Site Reporter Gene LacZ Hybrid 1 chromosome

8. How do we make recombinant plasmids? How do they work? Recombinant Plasmid Recombinant Plasmid Transform into yeast Activation Domain MS2 rProtein RNA-X aPTC Protein MS2 Activation Domain MS2 RNA-Binding Protein Hybrid 2 Hybrid 3 Yeast in vivo DNA Binding Protein DNA Binding Site Reporter Gene LacZ Hybrid 1 chromosome

9. Hybrid gene expression vectors • Cloning site to insert gene of interest and create hybrid gene • Yeast promoter to express hybrid gene • Yeast selective marker • Yeast origin of replication • E. coli selective marker • E. coli origin of replication How do we clone in the gene of interest?

10. Recombinant DNA technology • Digest plasmid and gene of interest with specific restriction enzymes • - “sticky end” overhangs • Dephosphorylatelinearized plasmid • Ligate vector and insert • Transform ligation into E. coli • Confirm insert with PCR and sequence analysis How do we get the gene of interest with the necessary restriction sites? http://163.16.28.248/bio/activelearner/14/ch14summary.html

11. PCR amplify gene of interest restriction sequence forward primer target gene genomic DNA reverse primer restriction sequence PCR

12. Primer Design restriction sequence • Primer sequence • complementary to beginning and end of target gene specifically • should have no or low sequence similarity to other DNA • approximately 20 nt long • Tm approximately 60-65°C • Restriction sequence • must be absent in target sequence • must match restriction sites used to digest plasmid forward primer reverse primer restriction sequence

13. Recombinant DNA technology • Digest plasmid and gene of interest with specific restriction enzymes • - “sticky end” overhangs • Dephosphorylatelinearized plasmid • Ligate vector and insert • 4. Transform ligation into E. coli • 5. Confirm insert with PCR and sequence analysis http://163.16.28.248/bio/activelearner/14/ch14summary.html

14. Transformation into E. coli ampicillin http://www.odec.ca/projects/2006/sidh6h2/bg.html

15. Colony PCR to confirm insert forward primer reverse primer transformation plate colony PCR Extract plasmids and send for sequencing “patch” plate

16. Sequence analysis of insert - chromatogram GOOD! BAD!

17. Sequence analysis of insert - alignment GOOD! AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC C G AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC maybe OK AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC C G CCGA GA - G ATGAC TGAC- AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC BAD!

18. Recombinant plasmids for the yeast three- hybrid analysis Recombinant Plasmid Recombinant Plasmid Transform into yeast Activation Domain MS2 rProtein RNA-X aPTC Protein MS2 Activation Domain MS2 RNA-Binding Protein Hybrid 2 Hybrid 3 Yeast in vivo DNA Binding Protein DNA Binding Site Reporter Gene LacZ Hybrid 1 chromosome

19. Co-transformation both plasmids into yeast • Yeast strain is mutant: • ΔLEU2, ΔADE2, ΔURA3, ΔTRP1, ΔHIS3 • Selective plates lack leucine and adenine http://2011.igem.org/Team:WashU/Notebook/Transformation

20. Yeast three hybrid assay for RNA-protein interactions • Construct vectors • PCR amplify insert • Restriction digest plasmids and insert • Ligate vector and insert • Transform ligation into E. coli • Colony PCR to screen for inserts • Sequence confirmation of inserts • Transform plasmids into yeast • Colony lift assay (qualitative) • Beta-galactosidase assay (quantitative)

21. Yeast 3 Hybrid Experiment Activation Domain MS2 L4 aPTC aPTC L4 MS2 CM-AL = Media with all nutrients EXCEPT adenine and leucine Activation Domain MS2 Coat Protein DNA Binding Protein Yeast in vivo DNA Binding Site LacZ chromosome

22. Colony lift assay • “Lift” colonies onto sterile filter paper • Add X-gal • galactose linked to a substituted indole. • turns blue when cleaved by β-galactosidase (LacZ) • Blue spots = positive RNA-protein interaction • Qualitative only (5-bromo-4-chloro-indolyl-β-D-galactopyranoside)

23. Quantitative β-galactosidase Assay • Grow replicates in 96-well plates • Add ONPG (ortho-Nitrophenyl-β-galactoside) • colorimetric and spectrophotometric • galactoselinked toortho-nitrophenol • Turns yellow and has O.D. at 420 nm wavelength when cleaved by β-galactosidase • OD420nm = “strength” of RNA-protein interaction

24. In vivo interactions of a-rRNA γ and DIII with L2, L3, L4, L15, L22, L23, and L34 RNA Hybrid What are your conclusions from this graph?

25. Thanks!