From Gene to Protein

From Gene to Protein SLIDE SHOW BY KIM FOGLIA (modified)All Blue edged slides are Kim’s(hyperlinks may have been added) How Genes Work

What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? _____________ ____________ RNA DNA protein trait DNA gets all the glory, but proteins do all the work! _______________

A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

1941 | 1958 Beadle & Tatum ________________________hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum create mutations positive control negative control mutation identified experimentals amino acidsupplements

aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

RNA • ____________ sugar • N-bases • _______ instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS RIBOSOMAL RNA (rRNA) Made in ______________ 2 subunits (large & small) Combine with proteins to form ribosomes Bacterial ribosomes differentsize than eukaryotic ribosomes • Evidence for ENDOSYMBIOTIC THEORY • Medically significant-some antibiotics targetbacterial ribosomes w/o harming host rRNA and t-RNA images from Image from: Biology; Miller and Levine; Pearson Education publishing as Prentice Hall; 2006 mRNA image from http://wps.prenhall.com/wps/media/tmp/labeling/1140654_dyn.gif

3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS TRANSFER RNA (tRNA) ________________ sequence matches CODON on mRNA to add correct amino acids during protein synthesis AMINOACYL-tRNA SYNTHETASE Enzyme attaches a specific amino acid using energy from ATP http://www-math.mit.edu/~lippert/18.417/lectures/01_Intro/

3 KINDS OF RNA HELP WITH INFO TRANSFER FOR PROTEIN SYNTHESIS MESSENGER RNA (mRNA) carries code from DNA to ribosomes

Transcription Transcription • Making mRNA • transcribed DNA strand = _____________ strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

RNA polymerases • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

Which gene is read? • Promoter region • binding site before beginning of gene • TATA box binding site • binding site for RNA polymerase & transcription factors • Enhancer region • binding site far upstream of gene • turns transcription on HIGH

Transcription Transcription Factors • Initiation complex • transcription factors bind to _____________region • suite of proteins which bind to DNA • hormones? • turn on or off transcription • trigger the binding of RNA polymerase to DNA

RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

mRNA’s require EDITING before use • Message in NOT CONTINUOUS • INTRONS are removed Image by Riedell

intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = ______________ • mRNA splicing • edit out _____________ • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia

Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Whoa! I think we just brokea biological “rule”! RNA splicing enzymes • ______________ • small nuclear RNA • proteins • ______________ • several snRNPs • recognize splice site sequence • cut & paste gene No, not smurfs! “snurps”

PROCESSING RNA mRNA EDITING SPLICEOSOMES ALL ENZYMES ARE PROTEINS? ______________-RNA molecules that function as enzymes (In some organisms pre-RNA can remove its own introns)

Alternative splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons Starting to gethard to define a gene!

3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add ____________ cap • add ____________ tail • longer tail, mRNA lasts longer: produces more protein

Translation fromnucleic acid languagetoamino acid language

TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine

1960 | 1968 Marshall Nirenberg Har Khorana • Determining the code

The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

____________ RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

Protein synthesis/quiz Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

Protein synthesis 2 Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

3 2 1 How translation works Building a polypeptide • ________________ • brings together mRNA, ribosome subunits, initiator tRNA • _________________ • adding amino acids based on codon sequence • _________________ • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • ______________________ • address label start of a secretory pathway

RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional unit (gene?) transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

SEE PROCESSING VIDEO Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

COMPLETING PROTEINS • POLYRIBOSOMES (POLYSOMES) • Numerous ribosomes translate same mRNA at same time • 3-D folding (1’, 2’, 3’ structure) • Chaparonins

POST-TRANSLATIONAL MODIFICATIONS • Some amino acids modified by addition ofsugars, lipids, phosphate groups, etc • Enzymes can modify ends, cleave into pieces join polypeptide strands (4’ structure) Ex: Made as proinsulin then cut Final insulin hormone made of two chains connected by disulfide bridges http://www.vivo.colostate.edu/hbooks/pathphys/endocrine/pancreas/insulin.html

1st to suggest genes dictate phenotypes through enzymes that catalyze specific chemical reactions • Postulated that the symptoms of an inherited disease are due to inability to make a specific enzyme • Coined term “inborn errors of metabolism” to describe such diseases • Beginning of “One gene-one enzyme” hypothesis • ALCAPTONURIA- “black urine” disease- defect in enzyme that breaks down amino acid tyrosine ARCHIBALD GARROD 1902 http://www.personal.psu.edu/faculty/w/x/wxm15/Online/Molecular%20Biology/media/phenylalanine.gifhttp://www.nature.com/bjp/journal/v147/n1s/images/0706466f5.jpg

From Gene to Protein