Bioinformatics BITO-215

1. BioinformaticsBITO-215 Ayesha Masrur Khan Spring 2013

2. Course Outline Introduction to Bioinformatics • Definition of Bioinformatics and Related Fields • Earliest Bioinformatics Efforts • Objective and Scope of Bioinformatics • Kind of Data Used in Bioinformatics • Introduction to Databases • Major Biological Databases Sequence Alignment • Pairwise Sequence Alignment • Database Similarity Searching • Multiple Sequence Alignment • Profiles and Hidden Markov Models • Protein Motifs and Domain prediction Introduction

3. Course Outline..contd. Gene and Promoter Prediction • Gene Prediction • Methods of Gene Prediction • Gene Prediction tools • Promoter and Regulatory Element Prediction • Promoter and Regulatory Element Prediction Tools Molecular Phylogenetics • Phylogenetic Basics • Phylogenetic Tree Construction Methods and Programs • Phylogenetic Tree Evaluation Structural Bioinformatics • Protein Structure Basics • Protein Structure Visualization Tools • Protein Secondary Structure Prediction • Protein Tertiary Structure Prediction • Protein Structure Prediction Tools • RNA Structure Prediction Methods and Tools Introduction

4. Course Outline..contd. Genomics and Proteomics • Introduction to Genomics • Tools for Genome Analysis • Genome Mapping, Assembly and Comparison • Functional Genomics • Introduction to Proteomics • Tools for Proteome Analysis • Advanced topics • Molecular dynamics simulation • Computational drug design • Microarray data analysis Introduction

5. Recommended Books • Introduction to Bioinformatics, by T. K. Attwood and D.J. Parry-Smith (2006) Pearson Education, Ltd. • Introduction to Bioinformatics: A Theoretical and Practical Approach, by Stephen A. Krawetz and David D. Womble. • Essential Bioinformatics, by Jin Xiong(2006) Cambridge University Press. Introduction

6. Course Assessment Assignment: 10% Quizzes: 10 % Sessional-1: 15 % Sessional-2 (project + presentation): 20% Terminal Exam: 45% Introduction

7. Central Paradigm of Molecular Biology Introduction

8. Central Paradigm of Bioinformatics Introduction

9. What is Bioinformatics? • Information technology applied to the management and analysis of biological data. • It was originally coined in the mid-1980s for the analysis of biological data. • It can include computational manipulation and analysis of biological sequence data, as well as manipulation and analysis of three-dimensional structural data. • What laid the foundation of this revolutionary field? • Protein sequencing and Nucleic acid sequencing in the 60’s and 70’s paved the way for sequence revolution and hence the 80’s saw progress in computer-based technologies to cope with this surge in information Introduction

10. What is Bioinformatics? • Bioinformatics is conceptualizing biology in terms of molecules (in the sense of physical-chemistry) and then applying “informatics” techniques (derived from disciplines such as applied math, CS, and statistics) to understand and organize the information associated with these molecules, on a large-scale. Introduction

11. Related fields Systems Biology Proteomics: Study of the entire complement of proteins (proteome) Structural Genomics: Pursuance of protein structures on a genome wide scale. Genomics: Study of genomes of organisms. Systems Biology: Studies the complex systems which exist within and across multiple biological scales Introduction

12. Raw DNA Sequence atggcaattaaaattggtatcaatggttttggtcgtatcggccgtatcgtattccgtgcagcacaacaccgtgatgacattgaagttgtaggtattaacgacttaatcgacgttgaatacatggcttatatgttgaaatatgattcaactcacggtcgtttcgacggcactgttgaagtgaaagatggtaacttagtggttaatggtaaaactatccgtgtaactgcagaacgtgatccagcaaacttaaactggggtgcaatcggtgttgatatcgctgttgaagcgactggtttattcttaactgatgaaactgctcgtaaacatatcactgcaggcgcaaaaaaagttgtattaactggcccatctaaagatgcaacccctatgttcgttcgtggtgtaaacttcaacgcatacgcaggtcaagatatcgtttctaacgcatcttgtacaacaaactgtttagctcctttagcacgtgttgttcatgaaactttcggtatcaaagatggtttaatgaccactgttcacgcaacgactgcaactcaaaaaactgtggatggtccatcagctaaagactggcgcggcggccgcggtgcatcacaaaacatcattccatcttcaacaggtgcagcgaaagcagtaggtaaagtattacctgcattaaacggtaaattaactggtatggctttccgtgttccaacgccaaacgtatctgttgttgatttaacagttaatcttgaaaaaccagcttcttatgatgcaatcaaacaagcaatcaaagatgcagcggaaggtaaaacgttcaatggcgaattaaaaggcgtattaggttacactgaagatgctgttgtttctactgacttcaacggttgtgctttaacttctgtatttgatgcagacgctggtatcgcattaactgattctttcgttaaattggtatc……………………………………………….…………………………..caaaaatagggttaatatgaatctcgatctccattttgttcatcgtattcaacaacaagccaaaactcgtacaaatatgaccgcacttcgctataaagaacacggcttgtggcgagatatctcttggaaaaactttcaagagcaactcaatcaactttctcgagcattgcttgctcacaatattgacgtacaagataaaatcgccatttttgcccataatatggaacgttgggttgttcatgaaactttcggtatcaaagatggtttaatgaccactgttcacgcaacgactacaatcgttgacattgcgaccttacaaattcgagcaatcacagtgcctatttacgcaaccaatacagcccagcaagcagaatttatcctaaatcacgccgatgtaaaaattctcttcgtcggcgatcaagagcaatacgatcaaacattggaaattgctcatcattgtccaaaattacaaaaaattgtagcaatgaaatccaccattcaattacaacaagatcctctttcttgcacttgg 4 bases: AGCT ~1 K in a gene, ~2 M in genome Introduction

13. Protein Sequence 20 letter alphabet: ACDEFGHIKLMNPQRSTVWY Strings of ~300 aa in an average protein (in bacteria) 200 K known protein sequences Introduction

14. Homework: State what amino acid each of the 20 letters stand for Introduction