Development of molecular approaches in the study of lettuce downy mildew ( Bremia lactucae ) population biology Presente

1. Development of molecular approaches in the study of lettuce downy mildew (Bremia lactucae) population biologyPresented by Limin Xu

2. Bremia lactucae (lettuce downy mildew) It is the pathogen causes serious disease of lettuce that occurs worldwide and reduces the yield. The symptoms are speckled, yellowed lesions often angular that are bound by leaf veins.

3. Disease cycle of downy mildew caused by B. lactucae Introduction • Oomycete • Obligate biotroph • Specific host-pathogen interaction shown

4. Bremia lactucae infection of lettuce • Resistance (DM) genes identified in lettuce and used in breeding • However resistance trends to break down rapidly • Host-pathogen interaction demonstrated • Putative Avirulence (Avr) genes identified (R. Michelmore, UC Davis)

5. Aim • to investigate the use of molecular methods to study population structures and the biology of B. lactucae infections on lettuce.

6. Objectives of current work 1. Establish a B.lactuace race identification system using differential test sets of lettuce varieties. 2. Develop the PCR-methods to determine the genetic variability of B.lactuace isolates. 3. Use molecular techniques to determine population change of B.lactucae on different lettuce cultivars

7. B.lactuace race identification system using differential test sets of lettuce varieties Nineteen lettuce cultivars’ seedling can be grown in a box with division for B.lactucae race identification

8. Differential test set of 16 lettuce varieties.

9. Figure 1. Denomination of B.lactucae isolates commonly used in breeding The differential test set of lettuce cultivars is based on that used by theInternational Bremia Evaluation Board (IBEB) (Arend et al., 2006). The results of the test give a unique value per isolate/race. Figure 1 is the denomination and identification of B.lactuace isolates commonly used in breeding which was also developed by IBEB, a joint effort of European lettuce breeders and authorities since 1998.

10. Material and Methodology B.lactucae spores collection: Culture on lettuce cv. Cobham Green to generate spores for DNA extraction. Table1. Isolates information DNA are extracted from the boiled washed spores without leaves tissues.

11. Results of Race Identification Table2. Results of the identification • Race identification using differential lettuce cultivar is slow. • Require a rapid method

12. ISSR • Can be designed without the knowledge about microsatellite regions • Good polymorphism and repetition • Can be developed to determine the genetic variability of B.lactucae

13. PCR base method: using the ISSR (Inter Simple Sequence Repeat) primers Table3. ISSR-primers for identification of B. Lactucae race, H= A, C, T; B=C, G, T; V=A, C, G; D=A, G, T (Wagner & Idczak, 2004)

14. Agarose gels could not separate the banding sufficiently • The Elchrom 6% Poly(NAT)® ready-to-use gels in the size range of 20 bp to 1,000 bp, were used to improve the resolution. Optimization gel electrophoresis

15. ISSR primers method for race identificationCluster analysis of banding patterns indicated that the three isolates were genetically distinct

16. These three isolates are genetically different . • Cobham green did not show any banding patterns. • Therefore, ISSR primers are useful molecular markers on identifying B. lactucae race.

17. Advantages and Disadvantages of ISSR • ISSR show potential for race identification • ISSR primers is not species specific • ISSR may not be robust for field detection.

18. Possible Solution • New downy mildew SSR ‘specific’ primers can be used to detect genetic differences. • 3 SSR primers are variable microsatellite loci in Plasmopara viticola but they are also can be amplified on B.lactucae according to F.Delmotte’s paper (2005): Pv14 L CAGAAACGCACAAGGTCTGA / Pv14 R AATTGCATACTGCAGCAACG Pv16 L TAAAAATATGGTGGCGTCAG / Pv16 RCCAGCAGTCTCCGTCTCATCAG Pv39 L ACGCATGGCGAACACGTAAG / Pv39 RCAGACGGGAAGAAGTTGCTC • Work underway using these primers to determine if they can detect variation between islates of B. lactucae

19. Future Marker Development SSR markers • Screening B. lactucae genome library • The SSR enrichment procedure • Literature/database searches Other types of markers • End sequencing of fosmid clone – Allele sequencing? SNPs? • Known Bremia latucae Avr gene? (conjunction with R. Michelmore, UC-Davis )

20. Conclusion ISSR is useful for B.lactucae race identification in culture… … but may not be robust for field studies downy mildew specific markers are currently under development/being tested.

21. Future Work • Collect more isolates of B.lactucae from lettuce production areas and from wild lettuce. • Test races using the phenotypic cultivar race identification and compare with molecular methods using the ISSR markers. • SSR markers development • Commence using markers for studies of field populations of B. lactucae.

22. Thanks Emily and Royand all the colleagues in our group

23. Thank you