Genetics of Neurodevelopmental Disorders

1. Genetics of Neurodevelopmental Disorders AP Monaco

2. Neurodevelopmental Disorders • Autism • Specific Language Impairment (SLI) • Developmental Dyslexia • Attention Deficit Hyperactivity Disorder

3. Summary of Talk • Why we think autism has genetic origins. • Strategies to identify genes involved in autism. • What have we discovered thus far. • The Autism Genome Project. • The search for further autism susceptibility genes.

4. AUTISM:a severe neurodevelopmental disorder • ‘…… an innate inability to form the usual biologically provided affective contact with people.’ Leo Kanner, 1943. • Characterised by impairments in three principal areas: • Verbal and non-verbal communication • Reciprocal social interaction • Repetitive and stereotyped patterns of interests and behaviours • Onset apparent before 3 years of age and persists throughout life • Population prevalence of autism is ~17-61 per 10,000. • Male to female ratio of ~4:1

5. Evidence for a genetic origin • Large number of chromosome abnormalities associated with autism. • Familial clustering of autism is well above the normal population prevalence. • Twin based studies.

6. mother father mother father child 1 child 2 child 3 child 4 Identical twins Non-Identical twins Twin Studies • Identical twins share 100% of their genes. • Non-identical twins share on average 50% of their genes.

7. ? ? affected unaffected Twin Studies Identical twins Non-Identical twins 60% concordance 0-3% concordance

8. GENETIC FACTORS IN AUTISM • Evidence from twin studies suggests a monozygotic (MZ) to dizygotic (DZ) concordance rate of 60%:0% (Bailey et al., 1995) • Heritability estimates of >90% • The rate among siblings of an autistic proband is ~3% • Autism is one of the most strongly genetic of the childhood-onset psychiatric disorders but no known mode of inheritance • Statistical modelling suggests the epistatic interaction of 3 genes, but possibly up to 10 loci • Family and twin studies indicate evidence for a broader autistic phenotype including combinations of milder but related social and/or communicative abnormalities in people of normal intelligence • MZ:DZ twin concordance rate for the broader phenotype ~92%:10% The Wellcome Trust Centre for Human Genetics.

9. Finding autism susceptibility genes: I. Chromosome abnormalitiesII. Linkage StudiesIII. Association Studies

10. a human cell a human The Human Genome 23 from mother 23 from father 23 pairs of chromosomes

11. 23 pairs of chromosomes Finding autism susceptibility genes: I. Translocations • Principle: To identify an individual (or several members of a family) with a chromosomal translocation and autism spectrum disorder.

12. Finding dyslexia susceptibility genes: I. Translocations • Principle: To identify an individual (or several members of a family) with a chromosomal translocation and reading impairment. Potential site for physical break in gene or regulatory element 23 pairs of chromosomes

13. Family 1 Family 2 Family 3 mother father mother father mother father child 1 child 2 child 1 child 2 child 1 child 2 Finding autism susceptibility genes: II. Linkage Studies • Principle: To identify regions of the genome inherited more often than by chance in individuals with autism. .... Family 300 Linked to autism

14. Finding autism susceptibility genes: III. Association Studies • Principle: To identify a genetic variant that is disproportionately more frequent in individuals with autism. Examples of genetic variants: - microsatellites - single nucleotide polymorphisms (SNPs) - insertions and deletions (INDELS) - combinations of the above (haplotypes)

15. Finding dyslexia susceptibility genes: III. Association Studies • Principle: To identify a genetic variant that is disproportionately more frequent in individuals with autism. Examples of genetic variants: - microsatellites - single nucleotide polymorphisms (SNPs) - insertions and deletions (INDELS) - combinations of the above (haplotypes) Associated to autism

16. THE INTERNATIONAL MOLECULAR GENETIC STUDY OF AUTISM CONSORTIUM (IMGSAC) Initial aims: Identify 200 multiplex families with two or more individuals with autism Clear inclusion (ADI and ADOS) and exclusion criteria Carry out a genome screen for autism susceptibility loci. 340 families now identified through clinics internationally U.K, Italy, Denmark, France, Greece, Germany, The Netherlands, U.S.A. The Wellcome Trust Centre for Human Genetics.

17. Autism Pathway Patient1 A* C* D* Patient2 B* C* E* F* Patient3 A* C* E* Patient4 B* C* E* Normal B* A B C D E F

18. GENOME SCREEN RESULTS 152 ASP 219 ASP The Wellcome Trust Centre for Human Genetics.

19. MLS > 3.6 MLS > 2.2 MLS > 1 AUTISM GENOME SCREEN RESULTS 8 genome screens for autism susceptibility loci carried out to date Genetic heterogeneity between studies? Some encouraging convergence of linkage findings eg chr 2, 7 The Wellcome Trust Centre for Human Genetics.

20. POSITIONAL CANDIDATE GENE SCREENING Strategy depends on the model for autism susceptibility • Multiple rare variants model • Exhaustive Candidate gene screening • No clear aetiological mutations involved in the majority of families • Rare mutations identified: NLGN, NRXN, SHANK3 • Common Disease, Common Variant model • High Resolution SNP/haplotype association mapping • Regional or Whole Genome Association studies The Wellcome Trust Centre for Human Genetics.

21. REGIONS FOR ILLUMINA SNP GENOTYPING The Wellcome Trust Centre for Human Genetics.

22. International HapMap Project • Genotyped individuals from four populations: • Yoruba (Nigerian) • Japanese • Han Chinese • Utah (US) = CEPH samples: • Northern and western European ancestry. • PHASE I to genotype 1,000,000 SNPs • PHASE II to genotype 5,000,000 more SNPs

23. Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean).

24. LOW recombination HIGH recombination Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks: • Regions of LOW recombinations. Haploview Daly Lab at the Whitehead Institute

25. Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). SNP number 1 2 3 4 5 6 7 8 9 FreqA T A A G C T A G 0.75C C A G A T C A G 0.10C C C A A T T G A 0.08C C A A A T T A G 0.06 123456789^^^ATAAGCTAGCCAGATCAGCCCAATTGACCAAATTAG 1234 Haplotype number

26. Haplotype block not covering any gene, therefore less need to genotype htSNPs. Gene not covered by haplotype block, so can not be tested. Segments of genes not covered by haplotype block, so can not be tested. Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). • Align haplotype blocks with genes. Important Points:

27. T/T G/G G/C A/C A/T G/C T/T T/C A/C Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). • Align haplotype blocks with genes. • Genotype 1536 htSNPs on the Illumina platform, utilising the GoldenGate assay, in the selected samples (cases and controls).

28. T/T G/G G/C A/C A/T G/C T/T T/C A/C TGC 0.80 TCG 0.15 AGC 0.05 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). • Align haplotype blocks with genes. • Genotype 1536 htSNPs on the Illumina platform, utilising the GoldenGate assay, in the selected samples (cases and controls). • Reconstruct haplotypes based on the htSNPs’ genotypes.

29. T/T G/G G/C A/C A/T G/C T/T T/C A/C TGC 0.80 TCG 0.15 AGC 0.05 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 association p-values 0.021 0.451 0.001 0.748 Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). • Align haplotype blocks with genes. • Genotype 1536 htSNPs on the Illumina platform, utilising the GoldenGate assay, in the selected samples (cases and controls). • Reconstruct haplotypes based on the htSNPs’ genotypes. • Test haplotypes for association to autism.

30. T/T G/G G/C A/C A/T G/C T/T T/C A/C TGC 0.80 TCG 0.15 AGC 0.05 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 AT 0.60 AA 0.25 CT 0.15 0.847 0.002 Autism Candidate Gene Summary Strategy Overview • Download CEPH HapMap genotypes. • Process genotypes (filter & clean). • Create haplotype blocks. • Identify haplotype-tagging SNPs (htSNPs). • Align haplotype blocks with genes. • Genotype 1536 htSNPs on the Illumina platform, utilising the GoldenGate assay, in the selected samples (cases and controls). • Reconstruct haplotypes based on the htSNPs’ genotypes. • Test haplotypes for association to autism. • Attempt to replicate any significant resultsin INDEPENDENT samples. association p-values 0.021 0.451 0.001 0.748

31. Chromosome 7 Probands v/s unrelated controls (population-based analysis)Experiment-wise posterior probability of association Strong evidence for association (90%) Positive evidence for association (75%) IMMP2L NM015328 PTPRZ1/2

32. LHFPL3 IMMP2L MUC3A/B WNT16 CUTL1 Family Based Analysis Probands v/s internal controls Experiment wise posterior probability of association Strong evidence for association 90% Positive evidence for association 75%

35. Summary of molecular genetics research • Several groups have carried out genome screens for linkage to autistic disorder. • Encouraging convergent evidence for linkage in some regions. • Many candidate gene screening and association studies have been carried out, but no etiological variants have been so far conclusively identified in the majority of families with autism. • High density SNP genotyping for association to autism on chromosome 7q and 2q have identified several positive risk haplotypes that need to be replicated. The Wellcome Trust Centre for Human Genetics.

36. Autism Genome Project • Genome-wide SNP genotypes (10k, 1M) • Copy Number Variation (CNV) • Linkage analyses • Association analyses • Trait subsets, endophenotypes, QTLs

37. Autism Genome Project • Consortium of consortia • Autism Genetics Cooperative (AGC) • Autism Genetics Research Exchange (AGRE) • Collaborative Programs of Excellence in Autism (CPEA) • International Molecular Genetic Studies of Autism Consortium (IMGSAC) • Pool autism family samples, phenotype data and expertise • Phase I • Genome-wide genotyping (10k) • Initial linkage analysis • Phase II • Association and Copy Number Variants

38. Autism Genome Project: Phase I • ~1400 multiplex families • Affymetrix 10k SNP genotypes • Basic linkage analysis • “autism” = affected (categorical Dx) • Narrow and broad autism and “heterogeneous ASDs” • Copy Number Variation • Use signal intensity data from adjacent/contiguous SNPs to infer copy number gains or losses • Linkage analyses in data subsets • Sex: Male-only, Female-containing • Ancestry: Western European • CNV: Removing CNV by different algorithms

39. Autism Genome ProjectCopy Number Variation and Genetic Linkage

41. 1q21 dups/dels: three families Previously implicated in MR Copy Number Variants 17p12 dups: three families SMS, CMT 2p16 deletion: 2 affected siblings NRX1 17 22q11.2 deletions: two families Interpretation complicated 22 • 17 de novo CNVs (10 found in both ASP) • 18 CNVs overlap ASD-related rearrangements • Numerous overlapping/recurrent CNVs • Families with transmission of maternal 15q gains 1 2

42. Copy Number Variation and Autism Risk:De Novo Mutation vs. Inherited Risk

43. CNV in Simplex and Multiplex Autism Families Sebat et al, Science 2007

44. Are CNVs more frequent in simplex families? Sebat et al, Science 2007 Are autism associated CNVs more likely to be sporadic “mutations” or inherited risk factors?

45. AGPPhase IIDesign

46. Summary • Autism has a complex genetic etiology • CNV is a major class of autism risk and causation • Need to clarify what is disease-related vs rare polymorphism • New information from genetic linkage studies • 11p and other regions targeted for candidate gene analysis • Whole genome association (WGA) studies will (hopefully) identify common liability alleles • Common = common in the general population • WGA does not identify genes with rare or infrequent risk or causative alleles • Sequence (autism genomes?) • Higher resolution CNV analysis • Collaboration is important to make progress in such complex disorders

47. Acknowledgments Nuala Sykes Ines Sousa Alistair Pagnamenta Richard Holt Kirsty Wing Gaby Barnby Penny Farrar Elena Bonora Tom Scerri Elena Maestrini Andrew Morris Janine Lamb Tony Monaco Tony Bailey autism@well.ox.ac.uk Funding MRC, Wellcome Trust, NLM Family Foundation, Simons Foundation, EU The Wellcome Trust Centre for Human Genetics.

48. International Molecular Genetic Study of Autism Consortium (IMGSAC)http://www.well.ox.ac.uk/~maestrin/iat.html • Denmark, Centre for Autisme, Bagsvaerd • France, Hôpital La Grave, Toulouse • Germany, Molecular Genome Analysis, Heidelberg • Dept of Psychiatry, Frankfurt • Greece, Agia Sophia Children’s Hospital, Athens • Italy,University of Bologna • The Netherlands,Dept of Psychiatry, Utrecht • U.S.A University of Chicago, Dept of Psychiatry UCLA Center for Neurobehavioural Genetics, Psychiatric Institute Yale University University of Pittsburgh, Dept of Human Genetics and Biostatistics University of Michigan, Autism & Communicative Disorders Center • U.K. • Dept of Psychiatry, University of Oxford • Wellcome Trust Centre, Univ of Oxford • Institute of Psychiatry, London • University of Cambridge, Dept of Psychiatry • Guy’s Hospital, London • University ofNewcastle, School of Clinical Medical Sciences • University ofManchester, School of Epidemiology & Health Science • ECACC, Porton Down The Wellcome Trust Centre for Human Genetics.

49. Autism Genome Project Genome-Wide Analysis of Linkage and Copy Number Variation Autism Genome Project Consortium: Autism Genetics Collaborative (AGC) Autism Genetics Resource Exchange (AGRE) Collaborative Programs of Excellence in Autism (CPEA) International Molecular Genetics Study of Autism Consortium (IMGSAC) Funding: UK: Medical Research Council USA: Autism Speaks Ireland:HRB Canada: Genome Canada