1 / 11

pMAL Protein Fusion and Purification System

pMAL Protein Fusion and Purification System. Overview. MBP-paramyosin  Sal. purified. separated. cleaved. uninduced. stop. induced. pMAL-c5X. P tac . Kit also includes pMAL-p5X – fusion protein exported to the periplasmic space. MCS. T2. T1. pMAL-5 MCS. XmnI. NdeI. NcoI.

Download Presentation

pMAL Protein Fusion and Purification System

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. pMAL Protein Fusion and Purification System

  2. Overview MBP-paramyosinSal purified separated cleaved uninduced stop induced

  3. pMAL-c5X P tac  Kit also includespMAL-p5X – fusion protein exported to the periplasmic space MCS T2 T1

  4. pMAL-5 MCS XmnI NdeI NcoI NotI EcoRV SalI BamHI EcoRI SbrfI ATCGAGGGAAGGATTTCACATATGTCCATGGGCGGCCGCGATATCGTCGACGGATCCGAATTCCCTGCAGGTAATTAAATAA I E G R GATGACGATGACAAGGTACCGCATATG ... D D D D K CCGGGTGCGGCACACTACGTACATATG ... P G A A H Y NdeI KpnI SnaBI NdeI • -core MCSidentical in K. lactispKLAC2 and Impact pTYB21 vectors • NdeI and NcoI facilitate cloning from unfused clones in pET vectors, etc. • contains 1 blunt and 2 eight-base sites • stop codons in all three frames

  5. Kit Components • pMAL-c5X, pMAL-p5X • Amylose resin • Factor Xa • MBP5 • MBP5-paramyosin∆Sal • Anti-MBP serum • NEB Express host cells • Manual

  6. 14 kDa 16 kDa 19 kDa 25 kDa 27 kDa 29 kDa MBP is good for solubility Shih et al., 2002, Protein Science 11:1714-19 32 yeast, mammalian, plant and insect genes Kapust & Waugh,1999, Protein Science 8:1668-74

  7. Expression and purification ofPNGaseF A B C D Expressed in pMAL-p2 Only active when expressed periplasmically MBP-PNGase F

  8. Cleavage of MBP-D. immitis antigen 5 Genenase I Factor Xa U 2 4 6 24 U M 2 4 6 24 MBP-Di5 MBP Di5

  9. pMAL companion products Antibodies Anti-MBP Antiserum Anti-MBP Monoclonal Antibody Anti-MBP Monoclonal Antibody (HRP conjugated) Anti-MBP Magnetic Beads Vectors pMAL-c5E Vector pMAL-c5G Vector pMAL-c5X Vector pMAL-p5E Vector pMAL-p5G Vector pMAL-p5X Vector pMAL-pIII Vector Binding matrices Amylose Resin Amylose Resin High Flow Amylose Magnetic Beads Proteins MBP5 Protein MBP5-paramyosin-ΔSal Specific proteases Enterokinase, light chain Factor Xa Protease Genenase I

  10. Sales

  11. Other systems NameTagSpecific proteaseCompany pQE-1,2 poly-histidineTAGzymeQiagen pQE-30 poly-histidine FXa Qiagen pQE-Trisystem poly-histidine, Streptag II Qiagen pGEX glutathione-S-transferase (GST) thrombin, factor Xa, 3c protease GE Life Sciences pET-HIS poly-histidine thrombin, FXa, enterokinase EMD pET-STag modified RNase thrombin, FXa, enterokinase EMD pET CBD cellulose-binding thrombin, FXa, enterokinase EMD pET Dsb S-Tag and poly-his thrombin, FXa, enterokinase EMD pDEST vectors GST, poly-histidine TEV protease, enterokinase Invitrogen pET-SUMO poly-histidine SUMO protease Invitrogen pRSET, pTrcHispoly-histidineenterokinaseInvitrogen plus others Halo tag poly-histidine TEV protease Promega PinPointbiotinylated E. coli protein factor Xa Promega Flag tag peptide epitope/monoclonal enterokinase Sigma

More Related