1 / 7

Macugen (pegaptanib)

Macugen (pegaptanib). Treats wet age-related macular degenration Pegylated nucleic acid Antiangiogenic: Stops vascular overgrowth Other options, but does not reverse Avastin (colon cancer drug) Lucentis (can actually restore vision—more common). Macugen – Macular Deneration.

uta
Download Presentation

Macugen (pegaptanib)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Macugen (pegaptanib) • Treats wet age-related macular degenration • Pegylated nucleic acid • Antiangiogenic: Stops vascular overgrowth • Other options, but does not reverse • Avastin (colon cancer drug) • Lucentis (can actually restore vision—more common)

  2. Macugen – Macular Deneration • wet age-related macular degenration (ARMD) • Overexpression of • protein VEGF 165: Vascular Endothelial Growth Factor • → vasculature crowds out photoreceptors

  3. Macugen – Active Ingredient • Aptamer – Anti-VEGF nucleic acid (50 kilodaltons) • (CGGAAUCAGUGAAUGCUUAUACAUCCG) • Binds to VEGF, preventing function (similar to other antiangiogenics; different molecule class)

  4. Macugen – Active Ingredient • ((2'-deoxy-2'-fluoro)C-Gm-Gm-A-A-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-Am-Gm-(2'-deoxy-2'-fluoro)U-Gm-Am-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Gm-(3'→3')-dT), 5'-ester with α,α'-[4,12-dioxo-6-[[[5-(phosphoonoxy)pentyl]amino]carbonyl]-3,13-dioxa-5,11-diaza-1,15-pentadecanediyl]bis[ω-methoxypoly(oxy-1,2-ethanediyl)], sodium salt.

  5. Macugen – Treatment • Technique: • Local anesthetic and antimicrobial • Intravitreal injection (“slight pressure”, but no pain) • Dose: 0.3 mg (1.6 mg pegylated) • Volume: 90 µL (pre-filled syringe)

  6. Macugen – Side Effects • (varying probability) • Air bubble in eye • Itchiness / Soreness • Eye floaters • Cataracts / blurred vision • Increased intravitreal pressure • Infection • Allergic reaction

  7. Macugen – Formulation • Drug provided as sodium salt • Coated in polyethylene glycol to reduce immune response and size in solution • Inactive ingredients: NaCl, NaPO_4*H20, HCl/NaOH • (counterions for drug-salt and pH adjustment)

More Related