1 / 19

Translation

Translation. from nucleic acid language to amino acid language. TACGCACATTTACGTACGCGG. DNA. AUGCGUGUAAAUGCAUGCGCC. mRNA. Met Arg Val Asn Ala Cys Ala. protein. ?. How does mRNA code for proteins?. How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?. 4. ATCG. 4.

winter
Download Presentation

Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Translation fromnucleic acid languagetoamino acid language

  2. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  3. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets called codons: Each codon calls for 1 amino acid

  4. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  5. Wobble? What is wobble?

  6. CAU GCA UAC Met Arg Val How are the codons matched to amino acids? tRNA finds the correct amino acid that responds to the codon and brings it to the ribosome 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  7. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  8. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  9. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  10. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  11. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  12. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • Signal peptide • address label start of a secretory pathway

  13. Can you tell the story? RNA polymerase DNA aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

  14. enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional unit (gene?) transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

  15. Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  16. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

  17. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  18. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

  19. Any Questions?? What color would a smurf turnif he held his breath?

More Related