560 likes | 929 Views
Resources and applications of TRC RNAi reagents in National RNAi Core Facility. Lecturer: 林志隆 ( IMB&RNAi Core). 05/14/2009/AS. The Nobel Prize in physiology /medicine 2006. RNAi: A gene silencing by dsRNA. RNA interference (RNAi). A form of post-transcriptional gene silencing,
E N D
Resources and applications of TRC RNAi reagents in National RNAi Core Facility Lecturer: 林志隆 ( IMB&RNAi Core) 05/14/2009/AS
The Nobel Prize in physiology /medicine 2006 RNAi: A gene silencing by dsRNA
RNA interference (RNAi) A form of post-transcriptional gene silencing, mimicking the effect of loss-of-gene-function. RNAi does not result in stable genetic changes; but in lower animal or plants, RNAi effects can be inherited for one or two generations.
Timeline of RNAi achievements Adapted from: http://www.invitrogen.com/content.cfm?pageid=10088
Dr. R Jorgensen’s Experiment Plant Cell. 1990 April; 2(4): 279. C Napoli, C Lemieux, and R Jorgensen • Attempts to overexpress chalcone synthase by inserting multiple copies of that gene into the plant’s genome. • Purple plants should become • purpler... • Co-suppression: both endogenous and introduced genes silenced. • PTGS – but what is the causative factor? PTGS= Post-Transcriptional Gene Silencing
PTGS in plants is due to small dsRNA dsRNA hypothesis explained this plant phenomenon Andrew J. Hamilton and David C. Baulcombe Science 1999 286: 950-52
dsRNA • C. elegans • Drosophila In mammal? IFN response in mammalian system---global gene silencing Long dsRNAs trigger non-specific silencing in mammalian
dsRNA-induced translation inhibition in mammalian Cytokine Growth Factor Rev. 2007 18:363-71.
Effector of RNAi Gregory Hannon identified the “Dicer” – an enzyme that chops double-stranded RNA into little pieces. cytosol small-interfering RNA; siRNA - Length of siRNA: 21 nts to 23 nts. Nature. 2000;404:293-6; Nature. 2001;409:363-6
DRCR8 Long dsRNA siRNA Biogenesis of RNAi
RISC: RNAi-induced silencing complex Guide/ antisense strand http://www.nature.com/focus/rnai/animations/index.html http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html
A U xG A High thermal stability of the Low thermal stability of the 5 ’ 5 ’ sense strand (SS) blocks anti - sense strand (AS) promotes Incorporation of AS into RISC. incorporation of SS into RISC AU rich is suggested. G or C is preferred. Low stability in this region enhances RISC/AS - mediated cleavage of mRNA and promote RISC complex release. U at position 10 at SS is recommended. Rational siRNA design 16 17 18 19 13 14 15 1 2 3 4 5 6 7 8 9 10 11 12 5’-P ’ 3 ’ - OH ’ P - 5 ’ ’ 3 ’ - OH Antisense strand Sense strand Reynolds et al. 2003
Other considerations • no high GC content (35-65%); • no inverted repeat sequence; • no consecutive 3 Gs or 3 Cs; • no consecutive 4 Ts if use polIII promoter; • mRNA secondary structure?
Phases of TRC Program The RNAi Consortium (TRC)The RNAi Core Phase I (May/2004 to Apr/2007) Jun/2005 to Apr/2008 Phase II (Oct/2007 to Sept/2011) May/2008 to Apr/2011
Vector Used by RNAi Core http://www.sigmaaldrich.com/Area_of_Interest/Life_Science/Functional_Genomics_and_RNAi/Product_Lines/shRNA_Library.html
Materials Received from TRC • shRNA constructs and knockdown information: • 35 shRNA expression vectors (some are intermediates). #1 Targeting 5,534 genes #2 Targeting 4,335 genes • with different selection/ fluorescence markers
Library performance-I (11,466 TRC shRNAs targeting 1,956 genes) TRC report
Library performance-II (11,466 TRC shRNAs targeting 1,956 genes) TRC report
Expression of Hairpin RNA (shRNA) Using Pol III Promoters • Transcription initiation of DNA-dependent RNApol III promoters (U6 or H1) are well characterized. RNApol III transcription uses a well-defined termination signal (TTTTT) and the products have no extra sequence. • Transcription from these promoters is very efficient in various tissues.
Structure of VSV-G-Pseudotyped Lentivirus Modified from http://www.washington.edu/alumni/columns/dec00/cells4.html
Replication of Retrovirus http://www.accessexcellence.org/RC/VL/GG/retrovirus.html
RRE SD Pol Gag SD SA SA Tat SV40 PolyA CMV promoter Rev ΔΨ SIN RSV promoter hPGK promoter AgeI Psi signal R-U5 EcoRI U3-R RRE U6 promoter Puro SV40 PolyA Genome Organization of Lentiviral Vector (Improved biosafety by eliminating non-essential genes or sequences) pLKO.1-puro: pbs PPT pCMVΔR8.91: VSV-G pMD.G: SV40 PolyA CMV promoter
HEK293T as Packaging Cells Procedures: Day1: seeding cells Day2: co-transfection Day3: re-fresh media Day4: harvest viruses/ re-add media Day5: harvest viruses http://www.systembio.com/lenti_vectors.htm
From genome sequence to gene function Function Genomics • What does the gene mean?
Forward and reverse genetics • Forward Genetics: • Reverse Genetics: start with a phenotype, find the gene. naturally occurring mutants can be used. start with a gene, determine its phenotype. identify the phenotypes resulting from the disruption of a particular gene.
Applications ofRNAi libraries RNA Interference Viral Infection Cancer Basic Research Gene functions • Tumor biology • Host factors required for viral replication • Biological pathways • And more •
siRNAPlasmid VectorViral Vector Viral Vector Transduction Transfection Transduction Selective screen for Altered Phenotype(s) High Throughput Assay for Altered Phenotype(s) Hits identification: Barcode microarray/ RT-PCR sequencing 2nd assay to validate hits Approaches to large-scale RNAi screen/selection Arrayed RNAi library/ScreenPooled RNAi library /Selection
R&D in RNAi Core Search for cellular factors that support primary human small airway epithelial cell (SAEC) growth using RNAipooled selection, 17 genes that support SAEC growing in soft agar are identified. Anchorage-dependent growth assay
How to ensure that hits aren't off-target ◙ Off-Target: ◙ How/ Criterion: Phenotype change is caused by two or more independent shRNAs that target the same gene ◙ Why:
Degradation of mRNA can occur by two separate pathways in RNAi Khvorova A. RNA (2008),14:853-861.
3’ UTR hexamer frequency in human genome SCF: seed complementary frequency high(>3800), medium (z2500–2800), or low (<350) SCFs in the HeLa transcriptome Khvorova A. RNA (2008),14:853-861.
Microarray signatures of GAPDH- and PPIB-targeting siRNAs One nt shift in seed sequence: GAPDH M1 sense: 5-GGCUCACAACGG GAAGCUU GAPDH M8 sense: 5-GCUCACAACGGG AAGCUUG Seed region not static Same seed sequences in different target genes: GAPDH H15 sense: 5-GAAGUAUGACAACAGCCUC PPIB H17 sense: 5-CGACAGUCAAGACAGCCUG Khvorova A. RNA (2008),14:853-861.
Seed sequence plays major role in off-target GAPDH high(>3800), medium (z2500–2800), or low (<350) SCFs in the HeLa transcriptome (z10 siRNAs for each group) Khvorova A. RNA (2008),14:853-861.
T GGGTCGAGCTGGACGGCGACGTAC C G TTTTTCAGCTCGACCTGCCGCTGCATG A shRNA processing How are the TRC library shRNAs processed into short dsRNAs? Implications: hairpin design, off-target effects polIII transcription start and stop; evidence for DROSHA processing? Where does DICER cut? 22 nts Which strand goes into RISC? (Strand that goes into RISC is more stable/abundant) TRC: Jen Grenier, Andrew Grimson, Ozan Alkan
Small RNA sequencing: all 26 shRNAs 23mer 5,217 1% 11% 22mer 32,279 7% 67% 21mer 8,029 2% 17% 20mer 1,029 <1% 2% Length #reads % shRNA % strand GG GG GG GG T GG21merSenseStrandSeqncC C G G21merAntisenseStrandSTTTTT A (5) 22mer 18,285 4% 5% 21mer 39,095 9% 10% 20mer 6,760 2% 2% 23mer 45,610 10% 11% 22mer 205,249 46% 51% 21mer 40,444 9% 10% 23mer 23,263 5% 6% 5Ts r 17% } r 4Ts 3Ts r (4) 5Ts e } 72% 4Ts e 3Ts e (3) 4Ts m
Highly parallel identification of essential genes in cancer cells Biao Luo etc, Proc Natl Acad Sci U S A, 2008, 105: 20380–20385.
Screens for essential genes in 12 cancer cell lines NSCLC SCLC leukemia glioblastoma
Time course analysis for the top 100 essential genes in K562 cells