Why is proper protein production so important?

1. Why is proper protein production so important?

2. Cystic Fibosis – most common genetic disease Progeria Porphyria

3. Achondrolplasia Tay Sach’s Sickle Cell Anemia

4. Developmental Abnormalities

5. Deoxyribose sugar ATGC are the bases Stable, immortal Double stranded 6 x 109 base pairs Ribose Sugar AUGC are the bases Unstable, short-lived Single Stranded Short pieces – made one gene at a time DNA vs. RNA

7. Types of RNA • mRNA – flat, single chain (no secondary structure) – directs protein production • tRNA – shaped like a cloverleaf, matches nucleotides in the mRNA with the correct amino acids • rRNA makes up the ribosome – actually catalyzes peptide bond formation

8. Whole Process of Protein Synthesis Transcription: making an mRNA copy of the DNA Translation: matching up the mRNA with the right aa – so building the protein

9. Transcription – making an mRNA copy of one gene

10. How do the transcription enzymes know where the beginning of each gene is and on what strand the gene is located? • The promoter is the beginning of the gene. It is a sequence of nucleotides where RNA polymerase binds to start transcription. • Every promoter has the sequence TATAAAA with ATATTTT on the opposite strand. This sequence is called the TATA box. This identifies the promoter. • The enzyme reads the non-TATA strand

11. Since only some genes are read in each cell, how does it know which genes to read and when to read them? • Beside the TATA box, the promoter has other DNA sequences that are specific to that gene. • Specific transcription factors bind to those sequences • RNA polymerase can’t bind to naked DNA – it can only bind to a promoter if it already has transcription factors bound to it • Each cell only has certain transcription factors and sometimes only activates them when signaled to.

12. Transcription Translation DNA → mRNA → Protein Transcription: • An enzyme (RNA polymerase binds to DNA at the start of a gene called the promoter (TATA box – TATAAAA) • As the RNA polymerase binds, it opens the DNA and begins to move forward, adding matching complementary ribonucleotides. It can only go in 1 direction. • As the RNA polymerase moves forward, the DNA recoils behind it, pushing the single strand of RNA off. This continues until the termination sequence. • RNA gains no secondary structure

13. Practice Give the mRNA transcript for the gene below: [GGCTAGGCAATATAAAAGCTTGG]AAAATGCGGGAATTC [CCGATCCGTTATATTTTCGAACC] TTTTACGCCCTTAAG AAAAUGCGGGAAUUC Copy the Non-TATA strand, don’t copy the promoter

14. RNA Processing • Cap is added to the front end – helps it leave the nucleus and bind to the ribosome, help protect the mRNA, and makes it go into the ribosome front first • Poly-A tail is added to the end (~200 A’s) – keeps mRNA from getting chewed up too fast • Splicing Splice out the introns, leave the exons Exons will actually code for the protein

15. RNA Processing DNA Exon Intron Exon Exon Intron Exon ↓ Pre-mRNA Cap- Exon Intron Exon Exon Intron Exon -AAA ↓ mRNA Cap- Exon Exon Exon Exon -AAA ↓ Cytoplasm

16. Practice: Give the final mRNA as it would look before it enters the cytoplasm: Stand #1: introns are red, exons are white [GGGCGATATTTTCCATG]TAATGCTACGGAGGC/ AACGGG/CCCAAATAGTACAGC/CGAGAC/CCGATC Strand #2: [CCCGCTATAAAGGTAC]ATTACGATGCCTCCG/ TTGCCC/GGGTTTATCATGTCG/GCTCTG/GGCTAG capAUUACGAUGCCUCCGGGGUUUAUCUGCGGCUAGtail

17. Explanation for practice answer • Reads non-TATA strand • Does not read the promoter • Adds complementary RNA nucleotides to match DNA nucleotides on the coding strand • Cuts out the introns after copying so not included in the final mRNA • A cap and a poly-A tail is added

18. Decoding - Translation Space A B C D E F G 0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21 H I J K L M N O 22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51 37,38,39 46,47,48 52,53,54 55,56,57 P Q R S T U V W 58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81 X Y Z 82,83,84 85,86,87 91,92,93 88,89,90 Code: 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0, 25,26,27,67,68,69,0,0,0,70,71,72,22,23,24,13,14,15,0,0,0,4,5,6,13,14,15, 67,68,69,70,71,72,0,0,0,7,8,9,37,38,39,1,2,3,67,68,69,67,68,69

19. Decoding - Translation Space A B C D E F G 0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21 H I J K L M N O 22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51 37,38,39 46,47,48 52,53,54 55,56,57 P Q R S T U V W 58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81 X Y Z 82,83,84 85,86,87 91,92,93 88,89,90 Code: 64,65,66,13,14,15,1,2,3,10,11,12,25,26,27,46,47,48,19,20,21,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0, 25,26,27,67,68,69,0,0,0,16,17,18,73,74,75,46,47,48

20. Decoding - Translation Space A B C D E F G 0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21 H I J K L M N O 22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51 37,38,39 46,47,48 52,53,54 55,56,57 P Q R S T U V W 58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81 X Y Z 82,83,84 85,86,87 91,92,93 88,89,90 Code: 25,26,27,0,0,0,34,35,36,52,53,54,76,77,78,13,14,15,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0,4,5,613,14,15,67,68,69,70,71,72

21. Making a Protein from mRNA • If each nucleotide = 1 aa – how many aa? • If 2 nucleotides = 1 aa – how many? • If 3? • 3 nucleotides = 1aa • Only 20 aa so it’s a degenerate code

22. Codon – triplet of mRNA that codes for an aa Anti-codon – triplet on tRNA that base pairs with mRNA tRNA has the anti- codon on one side and The amino acid on the other side so they match Up.

23. How does the ribosome know where to begin translation? • The cap leads the transcript into the ribosome in the right direction • The start codon (AUG) sets the reading frame (the correct sets of 3 nucleotides) • The start codon is always the first thing translated – it matches to the amino acid methionine

24. Translation • Processed mRNA binds to ribosome at the start codon (AUG on mRNA, anti-codon UAC, methionine aa) Sets the reading frame • tRNA attaches to start codon • Next tRNA binds to 2nd codon

25. Translation Continued • The 2 aa are covalently bonded (peptide bond) • The aa lose their attachment to the tRNA in the first site so both are only attached to the tRNA in the second site (so aa is transferred from it’s orginaltRNA to the new one) • The tRNA moves forward, dragging the mRNA with it. • The first tRNA falls off and goes to get a new aa in the cytoplasm

26. More Translation Translation Animation • The tRNA with the aa chain has moved down one codon. • A new tRNA and aa enters the open site and a peptide bonds forms between the new aa and the existing chain again transferring the chain of aa to the newest tRNA • The mRNA moves forward again and this continues until it reaches a stop codon (UAA, UAG, UGA) • The protein enters the RER.

27. Amino Acid Chart • Methionine • Proline • Leucine • Isoleucine • Proline • Lysine • stop

28. Post-translational ModificationsOnce inside the ER…. • aa’s can be removed • Lipids, carbs, sugars, phosphates may be added • The chain may be hooked up with another protein to form subunits of a protein with quarternary structure • The chain may be cut into smaller pieces that may hook together • Folds into tertiary structure

29. Mutations Changes in nitrogen bases in DNA How can mutations come about? • Errors in replication not picked up by the proofreading enzyme attached to DNA polymerase (about 3-6/replication) • Environmental insults • Radiation • UV rays from the sun • X-rays • TV, cell phones, high power lines • Radon gas • Chemicals – man-made and natural • Irritation – abestos, rubbing

30. Results of Mutation to the Individual Cell If a cell acquires a mutation : • Repair enzyme fixes it or if occurs during replication – proofreading enzyme fixes it • Cell dies • Cell makes mutated proteins, doesn’t effect cell or doesn’t read that gene anyway • Damage activates cell suicide (apoptosis) • Cell becomes cancerous if mutate apoptosis genes, cell cycle control genes, crawling genes, etc.) • If cell is a sperm or egg, the child now has that mutated DNA in every cell of the body

31. Types of Mutations • Point Mutations (1 single base change) • Due to Substitutions • DNA polymerase adds the wrong base • Environmental insult alters a base to look more like a different base – once copied it becomes permanent • Frame-shift mutations (shift the reading frame) • Deletions – lose a base • Insertions – add a base

32. Effects of Mutations on Proteins • Point Mutations (Substitutions) No change in protein Degenerate code – codes for same aa Change in non-coding region Changes 1 aa (change shape a lot or a little) Shortens protein – changes start codon so begins translation late Lengthens protein – changes stop codon so it keeps going through the trailer and poly-A tail

33. Effects of Insertions and Deletions • Frame-shift Mutations (changes the reading frame) • All aa are wrong after the insertion or the deletion • Only mutations in the sperm or egg can be passed onto to offspring! • Remember that mutations can be good, bad, or neutral to the organism!