460 likes | 1.29k Views
Basic Molecular Biology and Genetics. Biotechnology Toolbox for Synthetic Biology. Presenter: Damon Tighe. Outline:. History of biology and biotechnology (highly abbreviated) Crash Course in Molecular Biology Central Dogma of Molecular Biology DNA Replication, Transcription, Translation
E N D
Basic Molecular Biology and Genetics Biotechnology Toolbox for Synthetic Biology Presenter: Damon Tighe
Outline: • History of biology and biotechnology (highly abbreviated) • Crash Course in Molecular Biology • Central Dogma of Molecular Biology • DNA • Replication, Transcription, Translation • Protein • Basic Tools of Biotechnology • DNA Extraction (Lab) • Restriction Enzymes • Electrophoresis/Chromatography • PCR • DNA Sequencing • Synthetically building DNA • Protein technologies • Tying them all together - Insulin 15 min break
History of biology and biotechnology (highly abbreviated) Sumerian Beer Recipe Thales of Melitus Aristotle 3000BC 624-546BC 384-322BC Kyui and Kimchi Father of Biology Father of Philosophy 6000BC Olive Press fortune Categorical –Observation Wine in Armenia Ethics 6000BC Battle of Halys Teleology
History of biology and biotechnology (highly abbreviated) Birth of Microbiology Molecular Biology Natural Selection ~1650s – 1850s ~1850s – 1900s ~1900s – 1950s Charles Darwin Fridrich Miescher Anton van Leeuwenhoek Frederick Griffith et al. Louis Pasteur Alfred Russel Wallace Robert Koch Gregor Mendel Watson, Crick, Franklin
History of biology and biotechnology (highly abbreviated) PCR Human Genome Project Semi-Synthetic Life 1983 2010 1990-2003 Kary Mullis Ari Patrinos Craig Venter Francis Collins Synthetic Genome used to re-boot/reprogram an existing cell Target and amplify specific regions of DNA Craig Venter
Central Dogma of Molecular Biology Flow of information
DNA macromolecule of information
DNA DNA Structure/function Structure/function - -
DNA Structure/function – Eukaryotic packing
DNA Replication 5’ to 3’
Figure 10.6 Transcription of a Eukaryotic Gene (Part 2) DNA -> RNA
RNA Structure/function mRNA – messenger RNA 5’cap polyA tRNA – transfer RNA
DNA Transcription and Translation The Protein Code ( Translation of RNA to Amino Acids)
DNA Transcription and Translation
Protein Structure/function
Protein Structure/function Sickle Cell Anemia Single nucleotide mutation changes protein code, changes protein shape and function
Protein Protein function function Form defines Function: Enzymes – catalyze reactions by lowering activation energy Structural- collagen, keratin, etc Storage – act as a reservoir of amino acids – ovalalbumin Antibodies – immune system ability to pin point antigens Hormones – signaling molecules that travel long distance in the body Contractile – myosin, muscle fibers
Protein Enzymatic Pathways Carbs, fats, proteins
DNA Technology – Extraction/Isolation Scale to fit your application Ethanol Extraction – quick/crude, damaged DNA, but can work with it Phenol-Chloroform – laborious, but high quality DNA Animation of Fugu Fish Extraction Spin Columns – quick and easy, use resin to isolate DNA
DNA Technology – Restriction Enzymes Endonucleases Restriction site Palindrome
DNA Technology - Amplification Polymerase Chain Reaction (PCR) PCR Animation
DNA Technology - Cloning Restriction Enzyme PCR Product
DNA Technology - Sequencing Capillary Electrophoresis Illumina – highly parallel Ion Torrent
DNA Technology - Sequencing Pacific Biosciences Oxford Nanopore
Protein Technology – Production Price Per Gram Prices in US Dollars * As of 4/4/2012
Protein Technology – Production Production is constrained by the organism we use to produce the protein in. We are constrained in part by the choices of history and the momentum of technology.
Protein Technology – Chromatography • Ion Exchange (protein charge) • Size Exclusion (separates on size) • Hydrophobic Interaction (hydrophobicity) • Affinity: • Protein A tail of Antibodies • His-tagged metal complexes (Ni) • Glutathione-s-transferase glutathione
DNA -> Protein -> consumer product Insulin – protein used to treat Diabetes Melitus Thales of Melitus Eli Lilly (Indianapolis) Genentech Olive Oil Insulin Insulin
DNA -> Protein -> consumer product Extract DNA Clone into plasmid PCR Insulin Transform E.coli Grow E.coli Induce E.coli Selective pressure Harvest E.coli Proteins Purify Insulin via Chromatography
DNA Technology – Chemical DNA Synthesis ligase ligase oligonucleotide
Synthetic Biology GGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC