180 likes | 431 Views
12-1 DNA. Pg. 287. A. Griffith finds a ‘transforming principle.’. 1. Griffith experimented with the bacteria that cause pneumonia. 2. He used two forms: the S form (deadly) and the R form (not deadly). A. Griffith finds a ‘transforming principle.’.
E N D
12-1 DNA Pg. 287
A. Griffith finds a ‘transforming principle.’ • 1. Griffith experimented with the bacteria that cause pneumonia. • 2. He used two forms: the S form (deadly) and the R form (not deadly).
A. Griffith finds a ‘transforming principle.’ • 3. A transforming material passed from dead S bacteria to live R bacteria, making them deadly.
A. Griffith finds a ‘transforming principle.’ • 3. A transforming material passed from dead S bacteria to live R bacteria, making them deadly.
B. Avery identified DNA as the transforming principle. • 1. Avery isolated and purified Griffith’s transforming principle. • 2. Avery performed three tests on the transforming principle.
a. Qualitative tests showed DNA was present. • b. Chemical tests showedthe chemical makeupmatched that of DNA. • c. Enzyme tests showedonly DNA-degradingenzymes stoppedtransformation.
C. Hershey and Chase confirm that DNA is the genetic material. • 1. Hershey and Chase studied viruses that infect bacteria, or bacteriophages. • a. They tagged viral DNA with radioactive phosphorus. • b. They tagged viral proteins with radioactive sulfur. • 2. Tagged DNA was found inside the bacteria; tagged proteins were not. video
phosphate group nitrogen-containing base deoxyribose (sugar) D. The Components and Structure of DNA • 1. DNA is composed of four types of nucleotides. • 2. DNA is made up of a long chain of nucleotides. • 3. Each nucleotide has three parts. • a phosphate group • a deoxyribose sugar • a nitrogen-containing base
D. The Components and Structure of DNA • 4. DNA stands for DEOXYRIBONUCLEIC ACID!
5. The nitrogen containing bases are the only difference in the four nucleotides.
E. Watson and Crick determined the three-dimensional structure of DNA by building models. • 1. They realized that DNA is a double helix that is made up of a sugar-phosphate backbone on the outside with bases on the inside.
G C A T F. Nucleotides always pair in the same way. • 1. The base-pairing rules show how nucleotides always pair up in DNA. • A pairs with T • C pairs with G • 2. Because a pyrimidine (single ring) pairs with a purine (double ring), the helix has a uniform width.
Match the Nitrogen bases! • A • T • C • G • G • C • T • A • T • A • G • C • C • G • A • T
G. Watson and Crick’s discovery built on the work of Rosalind Franklin and Erwin Chargaff. • 1. Franklin’s x-ray images suggested that DNA was a double helix of even width. • 2. Chargaff’s rules stated that A=T and C=G.
covalent bond hydrogen bond • 3. The backbone is connected by covalent bonds. • 4. The bases are connected by hydrogen bonds.
Can you Find the CRIMINAL? • Fingerprints were found at a crime scene with the following DNA code? • ATTACGGCATTATTGCATTAGA • Who is Guilty??? • 1- TAAGCCATAGCGCATATATTTAT • 2- TAATGCCGTAATAACGATAGTA • 3- TAATGCCGTAATAACGTAATCT