'Hmg coa' presentation slideshows

Cholesterol and Steroid Metabolism

Cholesterol and Steroid Metabolism . UNIT III: Lipid Metabolism. I. Overview . Cholesterol, the characteristic steroid alcohol of animal tissues, performs a number of essential functions in the body.

2.1k views • 121 slides

Lipid Metabolism

Lipid Metabolism. http://www.expasy.org/cgi_bin/search_biochem_index/ http://www.tcd.ie/Biochemistry/IUBMB_Nicholson/ http://www.genome.ad.jp/kegg/metabolism.html/. Metabolic Functions of Eukaryotic Organelles. Lipid Digestion, Absorption, and Transport.

1.8k views • 104 slides

Lecture 13 Sept. 6, 2006

Lecture 13 Sept. 6, 2006. Fatty Acid Synthesis (Conlusion) Cholesterol Synthesis (Introduction) Lehninger (4 th Edition), Chapter 21 Amino Acid Oxidation (Introduction) Urea Cycle Lehninger (4 th Edition), Chapter 21. LNC Fig. 21-5. LNC Fig. 21-5. LNC Fig. 21-5. LNC Fig. 21-5.

967 views • 78 slides

High-Throughput Screening

2.29k views • 52 slides

LIVER

LIVER. Glucose. Ketone bodies. Glucose. Fatty acids. Glycerol. VLDL. Glucose can can NOT be made from fatty acids. TCA cycle. FED FASTING. Roles of Various Tissues in TG metabolism: MUSCLE. Glucose. Fatty acids. Ketone bodies. Glucose. Acetyl-CoA. Lactate (anaerobic).

1.04k views • 50 slides

638 views • 48 slides

METABOLIC CHANGES IN DIABETES MELLITUS & DIABETIC PREGNANT WOMAN DEPARTMENT OF BIOCHEMISTRY Siti Annisa Devi Trus

METABOLIC CHANGES IN DIABETES MELLITUS & DIABETIC PREGNANT WOMAN DEPARTMENT OF BIOCHEMISTRY Siti Annisa Devi Trusda. Humans are able to use a variable fuel input to meet a variable metabolic demand. Variable fuel input. storage fuels. O. 2. Variable. ADP + Pi. metab. demand. ATP.

761 views • 42 slides

???????? Red Yeast Rice

???????? Red Yeast Rice. Substan- tiation ??. Selection ??. Safety ???. Sourcing ??. Structure ??. Standard- ization ???. ????(??): 6 S ? ????????? Red Yeast Rice: The quintessential 6S Product. ????(??) Red Yeast Rice. ?? Red Yeast Rice (Monascus purpureus Went ).

780 views • 42 slides

Chapter 27. Biomolecules: Lipids

1.06k views • 38 slides

D- Cholesterol Synthesis

D- Cholesterol Synthesis. Hydroxymethylglutaryl-coenzyme A ( HMG-CoA ) is the precursor for cholesterol synthesis. HMG-CoA is also an intermediate on the pathway for synthesis of ketone bodies from acetyl-CoA.

505 views • 34 slides

INTERPATIENT VARIABILITY OF DRUG DISPOSITION & DOSAGE ADJUSTMENT

INTERPATIENT VARIABILITY OF DRUG DISPOSITION & DOSAGE ADJUSTMENT. Readings (Applied Biopharm & PK 5 th Ed.): Chp 12. Pharmacogenetics p 355-68. Chp 21. Renal & Hepatic Disease p 673-714 Chp 20. Peds/Geriatrics/Obesity p 634-42. Several articles will be posted on-line. Objectives.

1k views • 27 slides

Cholesterol Metabolism

Cardiovascular Block Dr. Sumbul Fatma. Cholesterol Metabolism. Introduction Cholesterol structure Cholesteryl esters Cholesterol synthesis Regulation of cholesterol synthesis Excretion of cholesterol Hypercholesterolemia and treatment. Overview. Most important animal steroid

1.4k views • 25 slides

BOARD REVIEW

BOARD REVIEW. NEPHROLOGY 2. Renal imaging. X Ray- all renal stones show up except uric acid Renal US- size, obstruction, masses, screening for Polycystic dz, stones> 5 mm IVP- non glomerular hematuria, renal stones, voiding disease, unexplained flank/ abdominal pain

463 views • 24 slides

Cholesterol Metabolism

Cardiovascular Block. Cholesterol Metabolism. Introduction Cholesterol structure Cholesteryl esters Cholesterol synthesis Rate limiting step Regulation of cholesterol synthesis Regulation of HMG CoA reductase Excretion of cholesterol Hypercholesterolemia and treatment. Overview.

1.39k views • 23 slides

Cholesterol Metabolism

Cholesterol Metabolism. Dr. Usman Ghani 1 Lecture Cardiovascular Block. Overview. Introduction Cholesterol structure Cholesteryl esters Cholesterol synthesis Rate limiting step Regulation of cholesterol synthesis Regulation of HMG CoA reductase Excretion of cholesterol

739 views • 23 slides

Qassim University College of Medicine Phase II Year II Cardiovascular System Block

Qassim University College of Medicine Phase II Year II Cardiovascular System Block. Cholesterol Metabolism Dr. Tarek A. Salem. Lecture objectives. Describe the structure of cholesterol and List its sources, precursors, functions and derivatives.

324 views • 23 slides

Biochemistry

Lipid metabolism

334 views • 19 slides

Section 7. Lipid Metabolism

Section 7. Lipid Metabolism. Steroids. 11/11/05. Membrane Properties. The distribution of lipids and proteins is asymmetric. Membranes have flexible and dynamic structures. The bilayer is fluid: lateral diffusion and protein structural fluctuations occur readily.

324 views • 19 slides

Anti-Hypercholesterolemic Agents

Anti-Hypercholesterolemic Agents. Biosynthesis and Metabolism of Cholesterol What is arteriosclerosis? - Link between arteriosclerosis and cholesterol Lipoproteins particles - Structure and classification of lipoprotein particles Hyperlipidemias

709 views • 15 slides

pyruvate + 3PGA

miR319: CCUCGAGGGAAGUCAGGUUU :::::::: :.::::.::: Target: UGAGCUCCCCUUAGUCUAAA. Carbon fixation. Sucrose Starch. Sugars. Glycolysis. Pyruvate. pyruvate + 3PGA. Acetyl-COA. MEP. HMG-CoA. IPP. DMAPP. MVA. GGPS. DMAPP. IPP. GGPP.

163 views • 1 slides