1 / 30

Forensic DNA Analysis (Part I)

Forensic DNA Analysis (Part I). Summary. What is DNA?. Where is DNA found in the body?. How does DNA differ among individuals?. Forensic DNA Analysis. DNA and Statistics. What is DNA?. What is DNA?. What does DNA stand for?. D eoxyribose N ucleic A cid or Deoxyribonucleic Acid.

illias
Download Presentation

Forensic DNA Analysis (Part I)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Forensic DNA Analysis (Part I)

  2. Summary • What is DNA? • Where is DNA found in the body? • How does DNA differ among individuals? • Forensic DNA Analysis • DNA and Statistics

  3. What is DNA?

  4. What is DNA? What does DNA stand for? Deoxyribose Nucleic Acid or Deoxyribonucleic Acid What does DNA do? • DNA contains genetic information. • DNA codes for the proteins our bodies make that are necessary for survival.

  5. What is DNA? DNA is a code for making proteins. AGC TAG CTT ATA CTC TAT CTC TTT Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid The order of amino acids determines what type of protein is made.

  6. What is DNA? Some common proteins are: • Hemoglobin - carries oxygen from lungs to cells • Insulin - regulates metabolism • Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy DNA also determines how much of these proteins each cell makes.

  7. What is DNA? What does DNA look like? Double Helix Like a Twisted Ladder

  8. What is DNA? What does DNA look like? Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs of Ladder)

  9. What is DNA? The DNA ladder is made up of building blocks called nucleotides. What is a nucleotide? Adenine Cytosine Guanine Thymine Phosphate Group Base Deoxyribose sugar

  10. The 4 Bases What is DNA? A Adenine C Cytosine T Thymine G Guanine

  11. What is DNA? The 4 Bases A C T G

  12. What is DNA? The 4 Bases The bases pair up to form the rungs of the ladder. A pairs with T G pairs with C

  13. What is DNA? DNA is written as the sequence of these bases: AAGTCGATCGATCATCGATCATACGT • Only one side of the ladder is written. • In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell.

  14. What is DNA? Among humans, most of the 3 billion bases in the DNA sequence are exactly the same. • Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another. • Human DNA is even 98% similar to chimpanzees. • NO TWO PEOPLE HAVE IDENTICAL DNA* *except identical twins

  15. What is DNA? Stupid Facts: • If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference. • If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide. • If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).

  16. Where is DNA?

  17. Where is DNA? DNA is found in the cells in our body. Nucleus (Brain of the cell) Mitochondria (more later)

  18. K-Fed sez: Quiz on Monday.

  19. Where is DNA? All types of cells in our body contain a copy of the same DNA.* Some cells important to forensic science are: White Blood Cell *Sperm Cell Cheek Cell

  20. Where is DNA? DNA in the nucleus is packaged into Chromosomes.

  21. Where is DNA? Chromosomes come in pairs (one from Mother) (one from Father) There are 46 chromosomes in each cell. (23 pairs)

  22. Where is DNA? What are sources of DNA at a crime scene? DNA can be recovered from any substance that contains cells. • Blood • Semen • Saliva • Tissue • Bone • Teeth • Hair • Maggot Crops

  23. Maggot Crop Where is DNA?

  24. How does DNA differ among Humans?

  25. How does DNA differ among humans? DNA is a sequence of 4 possible letters A G C T Of the 3 billion letters, 99.8% of the sequence in all humans is identical. There are several ways the sequence can be different. 

  26. How does DNA differ among humans? • One of the bases (letters) can be different. Person 1AGCTAGATCGTTATTCCGAG Person 2AGCTAGATCGTCATTCCGAG

  27. How does DNA differ among humans? Bases (letters) can be added or removed. Person 1AGCTAGATCGTTATTCCGAG Person 2AGCTAGATCGTATTCCGAG Person 3AGCTAGATCGTTTATTCCGAG Person 4AGCTCCGAG

  28. How does DNA differ among humans? Bases (letters) can be added or removed. Person 1AGCTAGATCGTTATTCCGAG Person 2AGCTAGATCGTATTCCGAG Person 3AGCTAGATCGTTTATTCCGAG Person 4AGCTCCGAG

  29. How does DNA differ among humans? Regions of DNA can be repeated a different # of times. Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..

  30. How does DNA differ among humans? Regions of DNA can be repeated a different # of times. Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 6 7

More Related